WormBase Tree Display for Variation: WBVar02123491
expand all nodes | collapse all nodes | view schema
| WBVar02123491 | Name | Public_name | WBVar02123491 | |||||
|---|---|---|---|---|---|---|---|---|
| Other_name | cewivar00854414 | |||||||
| Sequence_details | SMap | S_parent | Sequence | Y18D10A | ||||
| Flanking_sequences | TGTGAATCGGAAACTACGGGAGTAGATCCA | AGAAAATGCTCAAAAATGGTCTGAAAGTTG | ||||||
| Mapping_target | Y18D10A | |||||||
| Source_location | 225 | CHROMOSOME_I | 12866001 | 12878000 | From_analysis | Million_mutation_project_reanalysis | ||
| Type_of_mutation | Tandem_duplication | |||||||
| SeqStatus | Sequenced | |||||||
| Variation_type | Natural_variant | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Strain | WBStrain00022868 | From_analysis | Million_mutation_project_reanalysis | |||||
| Laboratory | VC | |||||||
| Analysis | Million_mutation_project_reanalysis | |||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00012482 | ||||||
| WBGene00012487 | ||||||||
| Transcript | Y18D10A.12.1 | |||||||
| Y18D10A.23.1 | ||||||||
| Remark | The boundaries of this variant have been identified only approximately | |||||||
| This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
| Method | WGS_Flibotte |
