WormBase Tree Display for Variation: WBVar02123491
expand all nodes | collapse all nodes | view schema
WBVar02123491 | Name | Public_name | WBVar02123491 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00854414 | |||||||
Sequence_details | SMap | S_parent | Sequence | Y18D10A | ||||
Flanking_sequences | TGTGAATCGGAAACTACGGGAGTAGATCCA | AGAAAATGCTCAAAAATGGTCTGAAAGTTG | ||||||
Mapping_target | Y18D10A | |||||||
Source_location | 225 | CHROMOSOME_I | 12866001 | 12878000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022868 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00012482 | ||||||
WBGene00012487 | ||||||||
Transcript | Y18D10A.12.1 | |||||||
Y18D10A.23.1 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |