WormBase Tree Display for Variation: WBVar02123487
expand all nodes | collapse all nodes | view schema
WBVar02123487 | Name | Public_name | WBVar02123487 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00854410 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_X | ||||
Flanking_sequences | CCAAAAAAAATTCTACATATAACGCTATCG | CAGTTTTCTTAAGAAAACAACTGGTTTGAT | ||||||
Mapping_target | CHROMOSOME_X | |||||||
Source_location | 225 | CHROMOSOME_X | 11779001 | 11797000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022856 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00219847 | ||||||
WBGene00013631 | ||||||||
WBGene00003332 | ||||||||
WBGene00003333 | ||||||||
WBGene00195666 | ||||||||
Transcript | C34E11.6 | |||||||
C34E11.9 | ||||||||
Y102F5A.1.1 | ||||||||
C34E11.5 | ||||||||
C34E11.20 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |