WormBase Tree Display for Variation: WBVar02123376
expand all nodes | collapse all nodes | view schema
WBVar02123376 | Name | Public_name | WBVar02123376 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00854299 | |||||||
Sequence_details | SMap | S_parent | Sequence | C29F9 | ||||
Flanking_sequences | TAAAAAAAAAACATCGTAGTTTATTGCTATAAATTGACAATTAACAATTAAATGGATACA | GTGAGGGCGAGCTTCGTAAAACAATGATAG | ||||||
Mapping_target | C29F9 | |||||||
Source_location | 225 | CHROMOSOME_III | 100001 | 120000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00022852 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00016221 | ||||||
WBGene00016225 | ||||||||
WBGene00219840 | ||||||||
WBGene00016220 | ||||||||
WBGene00016224 | ||||||||
Transcript | C29F9.6.1 | |||||||
C29F9.6.3 | ||||||||
C29F9.15 | ||||||||
C29F9.5.1 | ||||||||
C29F9.6.2 | ||||||||
Pseudogene | C29F9.11 | |||||||
C29F9.10 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |