WormBase Tree Display for Variation: WBVar02122995
expand all nodes | collapse all nodes | view schema
WBVar02122995 | Name | Public_name | WBVar02122995 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00853918 | |||||||
HGVSg | CHROMOSOME_I:g.6157999_6167998del | |||||||
Sequence_details | SMap | S_parent | Sequence | T09B4 | ||||
Flanking_sequences | AATATAGGTTAGATTCGGTTATGGAAAAAC | TTTTAAAACAAAGAAGAAATGACTGAATTT | ||||||
Mapping_target | T09B4 | |||||||
Source_location | 225 | CHROMOSOME_I | 6158001 | 6168000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00023286 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003328 | ||||||
WBGene00023136 | ||||||||
WBGene00020380 | ||||||||
WBGene00020381 | ||||||||
WBGene00020378 | ||||||||
WBGene00020382 | ||||||||
WBGene00201901 | ||||||||
WBGene00023135 | ||||||||
Transcript | T09B4.19 | VEP_consequence | transcript_ablation | |||||
VEP_impact | HIGH | |||||||
Exon_number | 1/1 | |||||||
T09B4.4.1 | VEP_consequence | 5_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | |||||||
cDNA_position | ?-53 | |||||||
Exon_number | 1/6 | |||||||
T09B4.8.1 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 2-7/8 | |||||||
Exon_number | 1-9/9 | |||||||
T09B4.6.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
Intron_number | 2-4/5 | |||||||
Exon_number | 1-4/6 | |||||||
T09B4.t1 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | |||||||
Exon_number | 1/1 | |||||||
T09B4.t2 | VEP_consequence | transcript_ablation | ||||||
VEP_impact | HIGH | |||||||
Exon_number | 1/1 | |||||||
T09B4.12 | ||||||||
Pseudogene | T09B4.7 | VEP_consequence | transcript_ablation | |||||
VEP_impact | HIGH | |||||||
Intron_number | 1-6/6 | |||||||
Exon_number | 1-7/7 | |||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |