WormBase Tree Display for Variation: WBVar02122729
expand all nodes | collapse all nodes | view schema
WBVar02122729 | Name | Public_name | WBVar02122729 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00853652 | |||||||
Sequence_details | SMap | S_parent | Sequence | F41B4 | ||||
Flanking_sequences | GCATCGAAAAGAACTCAATATTTAGAGAAC | TTTGGCTGTCGCATTAACATTGAAATACCC | ||||||
Mapping_target | F41B4 | |||||||
Source_location | 225 | CHROMOSOME_X | 6828001 | 6838000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00023139 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001617 | ||||||
WBGene00018258 | ||||||||
WBGene00018259 | ||||||||
Transcript | F41B4.4a.1 | |||||||
F41B4.2b.1 | ||||||||
F41B4.4b.1 | ||||||||
F41B4.2a.1 | ||||||||
F41B4.3.1 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |