WormBase Tree Display for Variation: WBVar02122648
expand all nodes | collapse all nodes | view schema
WBVar02122648 | Name | Public_name | WBVar02122648 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00853571 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_V | ||||
Flanking_sequences | AAGAAGAAGATACAGGTTCTATTAGTGTGG | GTGCATTCTCGGATTTTTACTTTAGCTGTT | ||||||
Mapping_target | CHROMOSOME_V | |||||||
Source_location | 225 | CHROMOSOME_V | 4026001 | 4048000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (3) | ||||||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00016782 | ||||||
WBGene00269425 | ||||||||
WBGene00005385 | ||||||||
WBGene00077593 | ||||||||
WBGene00019564 | ||||||||
WBGene00016788 | ||||||||
WBGene00016783 | ||||||||
WBGene00016785 | ||||||||
WBGene00016781 | ||||||||
WBGene00016786 | ||||||||
Transcript (13) | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |