WormBase Tree Display for Variation: WBVar02121137
expand all nodes | collapse all nodes | view schema
WBVar02121137 | Name | Public_name | WBVar02121137 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00852060 | |||||||
Sequence_details | SMap | S_parent | Sequence | F59E12 | ||||
Flanking_sequences | GAGAAGTCCGATGAGAGCGAAATATCCAAG | AATTGAGCAAGAATAAAACAATAAACTTTT | ||||||
Mapping_target | F59E12 | |||||||
Source_location | 225 | CHROMOSOME_II | 5621001 | 5637000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004602 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00015920 | ||||||
WBGene00019121 | ||||||||
WBGene00019122 | ||||||||
WBGene00235270 | ||||||||
WBGene00019120 | ||||||||
WBGene00019123 | ||||||||
WBGene00305468 | ||||||||
WBGene00235269 | ||||||||
Transcript (15) | ||||||||
Pseudogene | F59E12.16b | |||||||
F59E12.16c | ||||||||
F59E12.16a | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |