WormBase Tree Display for Variation: WBVar02121031
expand all nodes | collapse all nodes | view schema
WBVar02121031 | Name | Public_name | WBVar02121031 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00851954 | |||||||
Sequence_details | SMap | S_parent | Sequence | CHROMOSOME_IV | ||||
Flanking_sequences | AACTCTATTTTGCTAGTTGACAAATGTTTT | TTGTCAAATTTACGAGAACATTTTGGCGTA | ||||||
Mapping_target | CHROMOSOME_IV | |||||||
Source_location | 225 | CHROMOSOME_IV | 12466001 | 12487000 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain (7) | ||||||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00011420 | ||||||
WBGene00011418 | ||||||||
WBGene00007736 | ||||||||
WBGene00011417 | ||||||||
WBGene00011416 | ||||||||
WBGene00165722 | ||||||||
WBGene00167521 | ||||||||
WBGene00011419 | ||||||||
Transcript | C25G4.13 | |||||||
C25G4.10a.1 | ||||||||
C25G4.10b.1 | ||||||||
C25G4.12 | ||||||||
T04A11.4.1 | ||||||||
T04A11.2.1 | ||||||||
T04A11.5.1 | ||||||||
T04A11.1.1 | ||||||||
T04A11.3.1 | ||||||||
Remark | The boundaries of this variant have been identified only approximately | |||||||
This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | ||||||||
Method | WGS_Flibotte |