WormBase Tree Display for Variation: WBVar02120983
expand all nodes | collapse all nodes | view schema
WBVar02120983 | Name | Public_name | WBVar02120983 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00851906 | |||||||
CE32934:p.Ser289Ter | ||||||||
T12B5.8.2:c.865_866insAAGTGGTG | ||||||||
T12B5.8.1:c.865_866insAAGTGGTG | ||||||||
HGVSg | CHROMOSOME_III:g.940964_940965insCACCACTT | |||||||
Sequence_details | SMap | S_parent | Sequence | T12B5 | ||||
Flanking_sequences | AGCGAAATATCGAATTTGTCGTTACCATTC | GAATATTCGATATTAAATACGTTTTCGCCA | ||||||
Mapping_target | T12B5 | |||||||
Source_location | 225 | CHROMOSOME_III | 940953 | 944946 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Insertion | CACCACTT | ||||||
Tandem_duplication | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004600 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00020456 | ||||||
WBGene00023345 | ||||||||
WBGene00020455 | ||||||||
Transcript | T12B5.8.2 | VEP_consequence | stop_gained,frameshift_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | T12B5.8.2:c.865_866insAAGTGGTG | |||||||
HGVSp | CE32934:p.Ser289Ter | |||||||
cDNA_position | 883-884 | |||||||
CDS_position | 865-866 | |||||||
Protein_position | 289 | |||||||
Exon_number | 4/7 | |||||||
Codon_change | tcg/tAAGTGGTGcg | |||||||
Amino_acid_change | S/*VVX | |||||||
T12B5.10.1 | ||||||||
T12B5.8.1 | VEP_consequence | stop_gained,frameshift_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | T12B5.8.1:c.865_866insAAGTGGTG | |||||||
HGVSp | CE32934:p.Ser289Ter | |||||||
cDNA_position | 883-884 | |||||||
CDS_position | 865-866 | |||||||
Protein_position | 289 | |||||||
Exon_number | 4/6 | |||||||
Codon_change | tcg/tAAGTGGTGcg | |||||||
Amino_acid_change | S/*VVX | |||||||
Pseudogene | T12B5.9 | |||||||
Remark | This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | |||||||
Method | WGS_Flibotte |