WormBase Tree Display for Variation: WBVar02120980
expand all nodes | collapse all nodes | view schema
WBVar02120980 | Name | Public_name | WBVar02120980 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00851903 | |||||||
Sequence_details | SMap | S_parent | Sequence | T12B5 | ||||
Flanking_sequences | GATTTTTTTATGTACAGGTAAATGTCGAAA | CGAAATATCGAATTTGTCGTTACCATTTGA | ||||||
Mapping_target | T12B5 | |||||||
Source_location | 225 | CHROMOSOME_III | 940086 | 944918 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004600 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00020456 | ||||||
WBGene00023345 | ||||||||
WBGene00020455 | ||||||||
Transcript | T12B5.8.2 | |||||||
T12B5.10.1 | ||||||||
T12B5.8.1 | ||||||||
Pseudogene | T12B5.9 | |||||||
Remark | This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | |||||||
Method | WGS_Flibotte |