WormBase Tree Display for Variation: WBVar02120947
expand all nodes | collapse all nodes | view schema
WBVar02120947 | Name | Public_name | WBVar02120947 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | cewivar00851870 | |||||||
Sequence_details | SMap | S_parent | Sequence | Y46G5A | ||||
Flanking_sequences | TTAACGCATGTGTAATAATAAAATATCACT | TTTTTTCACGAGTGTGTAATAAGAAAATTT | ||||||
Mapping_target | Y46G5A | |||||||
Source_location | 225 | CHROMOSOME_II | 12795486 | 12795587 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Natural_variant | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00004600 | From_analysis | Million_mutation_project_reanalysis | |||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00012907 | ||||||
Transcript | Y46G5A.17.1 | |||||||
Y46G5A.17.2 | ||||||||
Remark | This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | |||||||
Method | WGS_Flibotte |