WormBase Tree Display for Variation: WBVar01500002
expand all nodes | collapse all nodes | view schema
WBVar01500002 | Name | Public_name | gk964178 | |||||
---|---|---|---|---|---|---|---|---|
Sequence_details | SMap | S_parent | Sequence | T25C12 | ||||
Flanking_sequences | ATTCGATTATCTGAAAGAGGCGGCAGGAAA | ACTGACAAATGTCAAAATCCTGTTTATTTT | ||||||
Mapping_target | T25C12 | |||||||
Source_location | 225 | CHROMOSOME_X | 11462009 | 11476431 | From_analysis | Million_mutation_project_reanalysis | ||
Type_of_mutation | Tandem_duplication | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | VC | |||||||
Analysis | Million_mutation_project_reanalysis | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00198772 | ||||||
WBGene00003003 | ||||||||
WBGene00199908 | ||||||||
WBGene00200941 | ||||||||
WBGene00197733 | ||||||||
WBGene00198856 | ||||||||
WBGene00201994 | ||||||||
Transcript | T25C12.5 | |||||||
T25C12.10 | ||||||||
T25C12.7 | ||||||||
T25C12.6 | ||||||||
T25C12.1a.1 | ||||||||
T25C12.8 | ||||||||
T25C12.9 | ||||||||
Reference | WBPaper00042537 | |||||||
Remark | This allele is a copy number variation determined from whole-genome sequence data, and should be assumed to be non-homozygous | |||||||
Method | Million_mutation |