WormBase Tree Display for Variation: WBVar01474051
expand all nodes | collapse all nodes | view schema
WBVar01474051 | Name | Public_name | tm6151 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_I:g.8218059_8218603del | |||||||
Sequence_details | SMap | S_parent | Sequence | T02E1 | ||||
Flanking_sequences | cttccaattctttgagtgtttctttgtttc | agaattttgaagtttttgattcatagtttt | ||||||
Mapping_target | T02E1 | |||||||
Source_location | 7 | CHROMOSOME_I | 8218058 | 8218604 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm6151_external | |||||||
tm6151_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 6151 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00000967 | ||||||
Transcript | T02E1.5b.1 | VEP_consequence | coding_sequence_variant,5_prime_UTR_variant | |||||
VEP_impact | MODIFIER | |||||||
cDNA_position | ?-229 | |||||||
CDS_position | ?-229 | |||||||
Protein_position | ?-77 | |||||||
Exon_number | 1/7 | |||||||
T02E1.5a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-223 | |||||||
CDS_position | ?-223 | |||||||
Protein_position | ?-75 | |||||||
Intron_number | 1/7 | |||||||
Exon_number | 1-2/8 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype | WBPhenotype:0001171 | Paper_evidence | WBPaper00059839 | ||||
Curator_confirmed | WBPerson42723 | |||||||
Remark | shortened lifespan upon exposure to S. maltophilia K279a, JCMS, and JV3 | Paper_evidence | WBPaper00059839 | |||||
Curator_confirmed | WBPerson42723 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00059839 | |||||
Curator_confirmed | WBPerson42723 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00059839 | ||||
Curator_confirmed | WBPerson42723 | |||||||
WBPhenotype:0001183 | Paper_evidence | WBPaper00054299 | ||||||
Curator_confirmed | WBPerson11083 | |||||||
Remark | Decreased TAG level (Figure 5) | Paper_evidence | WBPaper00054299 | |||||
Curator_confirmed | WBPerson11083 | |||||||
WBPhenotype:0002279 | Paper_evidence | WBPaper00054299 | ||||||
Curator_confirmed | WBPerson11083 | |||||||
Remark | Decreased lipid droplet size (Figure 5) | Paper_evidence | WBPaper00054299 | |||||
Curator_confirmed | WBPerson11083 | |||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00059839 | |||||
Curator_confirmed | WBPerson42723 | |||||||
Remark | NO lifespan phenotype upon exposure to E. coli OP50 | Paper_evidence | WBPaper00059839 | |||||
Curator_confirmed | WBPerson42723 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00059839 | |||||
Curator_confirmed | WBPerson42723 | |||||||
Phenotype_assay | Control_strain | WBStrain00000001 | Paper_evidence | WBPaper00059839 | ||||
Curator_confirmed | WBPerson42723 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National BioResource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00054299 | |||||||
WBPaper00059839 | ||||||||
Remark | 14390/14391-14935/14936 (545 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |