WormBase Tree Display for Variation: WBVar01429656
expand all nodes | collapse all nodes | view schema
WBVar01429656 | Evidence | Paper_evidence | WBPaper00041213 | ||||
---|---|---|---|---|---|---|---|
Name (3) | |||||||
Sequence_details | SMap | S_parent | Sequence | B0432 | |||
Flanking_sequences | tttaaaaactatgtgaagtcacacctgtct | atcattttgaaaatccgacctttttgcgaa | |||||
Mapping_target | B0432 | ||||||
Type_of_mutation | Deletion | ||||||
SeqStatus | Sequenced | ||||||
Variation_type | Allele | ||||||
Origin | Species | Caenorhabditis elegans | |||||
Strain | WBStrain00027527 | ||||||
Laboratory | MT | ||||||
Status | Live | ||||||
Affects | Gene | WBGene00004166 | |||||
WBGene00000296 | |||||||
Transcript (4) | |||||||
Genetics | Interpolated_map_position | II | -15.6718 | ||||
Description | Phenotype | WBPhenotype:0000641 | Paper_evidence | WBPaper00041213 | |||
Curator_confirmed | WBPerson461 | ||||||
Remark | Figure 3. The locomotion rates of cat-2 mutants were more variable than those of wild-type animals; Figure 4. cat-2 mutants achieve greater peak acceleration, resulting in large fluctuations in the speed within tracks. | Paper_evidence | WBPaper00041213 | ||||
Curator_confirmed | WBPerson461 | ||||||
Disease_info | Models_disease | DOID:14330 | |||||
Models_disease_in_annotation | WBDOannot00000970 | ||||||
Reference | WBPaper00041213 | ||||||
WBPaper00065310 | |||||||
WBPaper00065715 | |||||||
Method | Deletion_allele |