WormBase Tree Display for Variation: WBVar01429594

WBVar01429594 Name: Public_name: tm5932
    Other_name: F49E8.1a.1:c.234_636delinsGGCTTG
      F49E8.1b.1:c.234_636delinsGGCTTG
      CE51825:p.Pro79AlafsTer2
      CE33650:p.Pro79AlafsTer2
    HGVSg: CHROMOSOME_IV:g.7557486_7557932delinsGGCTTG
  Sequence_details: SMap: S_parent: Sequence: F49E8
    Flanking_sequences: aatttatgtttcaggcttgatcattccaaa atggttccaatgttcataagagaagtgacg
    Mapping_target: F49E8
    Source_location: 7 CHROMOSOME_IV 7557485 7557933 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: GGCTTG
      Deletion
    PCR_product: tm5932_external
      tm5932_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5932
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00018635
    Transcript: F49E8.1a.1 (11)
      F49E8.1b.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 14641/14642-GGCTTG-15088/15089 (447 bp deletion + 6 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele