WormBase Tree Display for Variation: WBVar01429544

WBVar01429544 Name: Public_name: tm5849
    Other_name: CE47376:p.Phe145LeufsTer8
      C28G1.1.1:c.432_692delinsG
    HGVSg: CHROMOSOME_X:g.8845248_8845779delinsG
  Sequence_details: SMap: S_parent: Sequence: C28G1
    Flanking_sequences: gtatcaaattggaagcactgtgatgccaaa ttacaatctcaagagtttcaatgaatctga
    Mapping_target: C28G1
    Source_location: 7 CHROMOSOME_X 8845247 8845780 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: G
      Deletion
    PCR_product: tm5849_external
      tm5849_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5849
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00006718
    Transcript: C28G1.1.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: X
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Remark: 18872/18873-G-19404/19405 (532 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele