WormBase Tree Display for Variation: WBVar00600938

WBVar00600938 Name: Public_name: tm5248
    Other_name: CE20445:p.Asp184GlyfsTer2
      B0212.5.1:c.549_919del
    HGVSg: CHROMOSOME_IV:g.3555598_3556013del
  Sequence_details: SMap: S_parent: Sequence: B0212
    Flanking_sequences: gcatttcctcgaaaatctgctttctaccca tcgtgtacaatggctaggtggagggctgat
    Mapping_target: B0212
    Source_location: 7 CHROMOSOME_IV 3555597 3556014 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm5248_external
      tm5248_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 5248
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003889
    Transcript: B0212.5.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: IV
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 15458/15459-15874/15875 (416 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele