WormBase Tree Display for Variation: WBVar00597660
expand all nodes | collapse all nodes | view schema
WBVar00597660 | Evidence | Paper_evidence | WBPaper00039980 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | bp242 | ||||||
Other_name | CE33215:p.Arg161Ter | |||||||
CE33216:p.Arg161Ter | ||||||||
Y39A1A.1b.1:c.481C>T | ||||||||
Y39A1A.1c.1:c.385C>T | ||||||||
Y39A1A.1d.1:c.160C>T | ||||||||
CE37799:p.Arg129Ter | ||||||||
CE45443:p.Arg54Ter | ||||||||
Y39A1A.1a.1:c.481C>T | ||||||||
HGVSg | CHROMOSOME_III:g.10598557G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | Y39A1A | ||||
Flanking_sequences | tggacgtatccagatgatattaaacaaatc | gatcggaagatattcgttcaaatccaaaag | ||||||
Mapping_target | Y39A1A | |||||||
Type_of_mutation | Substitution | c | t | Paper_evidence | WBPaper00039980 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00008602 | |||||||
Laboratory | HZ | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00012641 | ||||||
Transcript | Y39A1A.1d.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | Y39A1A.1d.1:c.160C>T | |||||||
HGVSp | CE45443:p.Arg54Ter | |||||||
cDNA_position | 160 | |||||||
CDS_position | 160 | |||||||
Protein_position | 54 | |||||||
Exon_number | 1/2 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
Y39A1A.1a.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y39A1A.1a.1:c.481C>T | |||||||
HGVSp | CE33215:p.Arg161Ter | |||||||
cDNA_position | 494 | |||||||
CDS_position | 481 | |||||||
Protein_position | 161 | |||||||
Exon_number | 4/6 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
Y39A1A.1c.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y39A1A.1c.1:c.385C>T | |||||||
HGVSp | CE37799:p.Arg129Ter | |||||||
cDNA_position | 390 | |||||||
CDS_position | 385 | |||||||
Protein_position | 129 | |||||||
Exon_number | 3/5 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
Y39A1A.1b.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | |||||||
HGVSc | Y39A1A.1b.1:c.481C>T | |||||||
HGVSp | CE33216:p.Arg161Ter | |||||||
cDNA_position | 488 | |||||||
CDS_position | 481 | |||||||
Protein_position | 161 | |||||||
Exon_number | 4/6 | |||||||
Codon_change | Cga/Tga | |||||||
Amino_acid_change | R/* | |||||||
Interactor (16) | ||||||||
Genetics | Interpolated_map_position | III | 3.8166 | |||||
Description | Phenotype (13) | |||||||
Phenotype_not_observed | WBPhenotype:0000114 | Paper_evidence | WBPaper00042320 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutants exhibited normal alg-1 and alg-2 and mRNA levels. | Paper_evidence | WBPaper00042320 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000414 | Paper_evidence | WBPaper00042320 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Loss of function of autophagy genes did not cause defects in ASEL fate specification, visualized by the ASEL-specific reporter lim-6pro::GFP. | Paper_evidence | WBPaper00042320 | |||||
Curator_confirmed | WBPerson712 | |||||||
Penetrance | Complete | Paper_evidence | WBPaper00042320 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000699 | Paper_evidence | WBPaper00042320 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Autophagy mutants did not show defects in vulval development. | Paper_evidence | WBPaper00042320 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000701 | Paper_evidence | WBPaper00042320 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutants exhibited normal seam cell development | Paper_evidence | WBPaper00042320 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000885 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | epg-6(bp242) mutants exhibited wild type kinetics of CED-1::GFP ring-like structure formation around cell corpses (Figure 1A,B) | Paper_evidence | WBPaper00044390 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | CED-1-GFP | Paper_evidence | WBPaper00044390 | ||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001346 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Actin cytoskeleton changes (assembly and disassembly) during cell corpse engulfment in epg-6(bp242) mutants were the same as in wild type (Fig. S2A and S2B), as determined by ACT-1-GFP fluorescence | Paper_evidence | WBPaper00044390 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Actin ring formation on corpse-engulfing phagosomes was not affected by the epg-6(bp242) mutation (Figure S3A,B), in the piki-1(ok2346) mutant background | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | GFP-ACT-1 | Paper_evidence | WBPaper00044390 | ||||
Curator_confirmed | WBPerson2987 | |||||||
piki-1(ok2346); GFP-ACT-1 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
WBPhenotype:0001846 | Paper_evidence | WBPaper00044390 | ||||||
Curator_confirmed | WBPerson2987 | |||||||
Remark | Actin ring formation on corpse-engulfing phagosomes was not affected by the epg-6(bp242) mutation (Figure S3A,B), in the piki-1(ok2346) mutant background | Paper_evidence | WBPaper00044390 | |||||
Curator_confirmed | WBPerson2987 | |||||||
Phenotype_assay | Genotype | piki-1(ok2346); GFP-ACT-1 | Paper_evidence | WBPaper00044390 | ||||
Curator_confirmed | WBPerson2987 | |||||||
Reference | WBPaper00039980 | |||||||
WBPaper00042320 | ||||||||
WBPaper00044390 | ||||||||
Method | Substitution_allele |