WormBase Tree Display for Variation: WBVar00317900

WBVar00317900 Evidence: Paper_evidence: WBPaper00037659
  Name: Public_name: snx328
    Other_name: IS656_945
      F54H5.4a.1:c.534-473C>G
      F54H5.4b.1:c.552-473C>G
      F54H5.4b.2:c.552-473C>G
    HGVSg: CHROMOSOME_II:g.6620959C>G
  Sequence_details: SMap: S_parent: Sequence: F54H5
    Flanking_sequences: GAAAATGACTGCGGTGGCGCTGCTTTCGACACGGTCAACGATCAGCTTAG GGGGGCCGCTTGTTTCGCGCGTTCCACAAAAGAATACAATCACAGATAAT
    Mapping_target: F54H5
    Type_of_mutation: Substitution: C G
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00022163
    Laboratory: IS
    Analysis: WGS_Jarriault
    Status: Live: Curator_confirmed: WBPerson4025
  Affects: Gene: WBGene00003480
    Transcript: F54H5.4b.2 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: F54H5.4b.2:c.552-473C>G
        Intron_number: 5/8
      F54H5.4a.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: F54H5.4a.1:c.534-473C>G
        Intron_number: 2/5
      F54H5.4b.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: F54H5.4b.1:c.552-473C>G
        Intron_number: 4/7
  Genetics: Map: II
  Reference: WBPaper00037659
  Remark: This was suppressed because it overlapped with a corrected genome sequence error feature Feature_evidence: WBsf268241
    This was un-suppressed after examination showed it is not changed by the corrected genome sequence error Curator_confirmed: WBPerson4025
  Method: WGS_Jarriault