WormBase Tree Display for Variation: WBVar00317304
expand all nodes | collapse all nodes | view schema
WBVar00317304 | Name | Public_name | tm5011 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | B0218.1.1:c.76-6_523+61delinsTG | ||||||||
B0218.1.3:c.76-6_523+61delinsTG | |||||||||
B0218.1.2:c.76-6_523+61delinsTG | |||||||||
HGVSg | CHROMOSOME_IV:g.8159691_8160205delinsTG | ||||||||
Sequence_details | SMap | S_parent | Sequence | B0218 | |||||
Flanking_sequences | caaaagttatttacttttaatgtttataaa | tttataggtccaggttcagaaattgagttt | |||||||
Mapping_target | B0218 | ||||||||
Source_location | 7 | CHROMOSOME_IV | 8159690 | 8160206 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Insertion | TG | |||||||
Deletion | |||||||||
PCR_product | tm5011_external | ||||||||
tm5011_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 5011 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00015047 | |||||||
Transcript | B0218.1.3 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0218.1.3:c.76-6_523+61delinsTG | ||||||||
Intron_number | 2-3/7 | ||||||||
Exon_number | 3/8 | ||||||||
B0218.1.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0218.1.1:c.76-6_523+61delinsTG | ||||||||
Intron_number | 2-3/7 | ||||||||
Exon_number | 3/8 | ||||||||
B0218.1.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||||
VEP_impact | HIGH | ||||||||
HGVSc | B0218.1.2:c.76-6_523+61delinsTG | ||||||||
Intron_number | 2-3/7 | ||||||||
Exon_number | 3/8 | ||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | IV | |||||||
Description | Phenotype | WBPhenotype:0001911 | Paper_evidence | WBPaper00041646 | |||||
Curator_confirmed | WBPerson1068 | ||||||||
Remark | Axon regeneration defective in adult D-type motor neurons. | Paper_evidence | WBPaper00041646 | ||||||
Curator_confirmed | WBPerson1068 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005303 | PATO:0000460 | Paper_evidence | WBPaper00041646 | ||||
Curator_confirmed | WBPerson1068 | ||||||||
WBbt:0005270 | PATO:0000460 | Paper_evidence | WBPaper00041646 | ||||||
Curator_confirmed | WBPerson1068 | ||||||||
Life_stage | WBls:0000041 | PATO:0000460 | Paper_evidence | WBPaper00041646 | |||||
Curator_confirmed | WBPerson1068 | ||||||||
GO_term | GO:0031103 | PATO:0001511 | Paper_evidence | WBPaper00041646 | |||||
Curator_confirmed | WBPerson1068 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Reference | WBPaper00041646 | ||||||||
Remark | 13263/13264-TG-13778/13779 (515 bp deletion + 2 bp insertion) | ||||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | |||||||
Method | NBP_knockout_allele |