WormBase Tree Display for Variation: WBVar00296280

WBVar00296280 Evidence: Paper_evidence: WBPaper00036384
  Name: Public_name: bp287
    Other_name: CE26989:p.Gln122Ter
      Y39G10AR.10.1:c.364C>T
      Y39G10AR.12a.1:c.1421+1902G>A
    HGVSg: CHROMOSOME_I:g.2300924C>T
  Sequence_details: SMap: S_parent: Sequence: Y39G10AR
    Flanking_sequences: aagatctggttgagcgactcgaaaaaattt aagaagctcttacgcggatctcagatgaga
    Mapping_target: Y39G10AR
    Type_of_mutation: Substitution: c t
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: HZ
    Status: Live
  Affects: Gene: WBGene00021470
      WBGene00021468
    Transcript: Y39G10AR.10.1 VEP_consequence: stop_gained
        VEP_impact: HIGH
        HGVSc: Y39G10AR.10.1:c.364C>T
        HGVSp: CE26989:p.Gln122Ter
        cDNA_position: 391
        CDS_position: 364
        Protein_position: 122
        Exon_number: 4/5
        Codon_change: Caa/Taa
        Amino_acid_change: Q/*
      Y39G10AR.12a.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: Y39G10AR.12a.1:c.1421+1902G>A
        Intron_number: 5/6
  Genetics: Interpolated_map_position: I -9.70998
  Description: Phenotype: WBPhenotype:0001300 Paper_evidence: WBPaper00036384
        Curator_confirmed: WBPerson712
        Remark: Somatic GFP::PGL-1-positive granules formed in embryos and large numbers of SEPA-1 aggregates persisted in late-stage embryos and early larvae whereas in control animals, P granules are selectively removed by autophagy during embryogenesis. In addition to the GFP reporters, endogenous PGL granule components PGL-1, PGL-3, and SEPA-1 also formed many aggregates and were colocalized. Paper_evidence: WBPaper00036384
            Curator_confirmed: WBPerson712
      WBPhenotype:0001645 Paper_evidence: WBPaper00036384
        Curator_confirmed: WBPerson712
        Remark: Endogenous PGL-3 protein levels remained high in late-stage mutant embryos, whereas pgl-3 mRNA levels were unchanged. Paper_evidence: WBPaper00036384
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000736 Paper_evidence: WBPaper00036384
        Curator_confirmed: WBPerson712
        Remark: Unlike other epg mutants, these mutants did no exhibit altered expression and accumulation of T12G3.1, C35E7.6 or ZK1053.4. Paper_evidence: WBPaper00036384
            Curator_confirmed: WBPerson712
      WBPhenotype:0001405 Paper_evidence: WBPaper00036384
        Curator_confirmed: WBPerson712
        Remark: T12G3.1 did not form large numbers of aggregates. Paper_evidence: WBPaper00036384
            Curator_confirmed: WBPerson712
      WBPhenotype:0001644 Paper_evidence: WBPaper00036384
        Curator_confirmed: WBPerson712
        Remark: Expression of T12G3.1 was not affected. Paper_evidence: WBPaper00036384
            Curator_confirmed: WBPerson712
  Reference: WBPaper00036384
  Method: Substitution_allele