WormBase Tree Display for Variation: WBVar00277462

WBVar00277462 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk2555
    Other_name: CE42370:p.Glu1032=
      F15D4.1.1:c.3096G>A
    HGVSg: CHROMOSOME_II:g.13209995G>A
  Sequence_details: SMap: S_parent: Sequence: W09E7
    Flanking_sequences: GATCTTTCCACTGCTCGCTGATCAATGTGA ACTGTCAGAGATGCTGCTGGAGAAGCATTC
    Mapping_target: W09E7
    Type_of_mutation: Substitution: G A
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00037340
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00000274
    Transcript: F15D4.1.1 VEP_consequence: synonymous_variant
        VEP_impact: LOW
        HGVSc: F15D4.1.1:c.3096G>A
        HGVSp: CE42370:p.Glu1032=
        cDNA_position: 3102
        CDS_position: 3096
        Protein_position: 1032
        Exon_number: 12/17
        Codon_change: gaG/gaA
        Amino_acid_change: E
  Isolation: Mutagen: ENU
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele