WormBase Tree Display for Variation: WBVar00276753

WBVar00276753 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5177
    Other_name: F57C7.12:n.14A>C
    HGVSg: CHROMOSOME_X:g.10594820A>C
  Sequence_details: SMap: S_parent: Sequence: F57C7
    Flanking_sequences: ACTGAACCTACTTCTTCAAATTACTATTGCCAAAAAGCTTGCCTCGAGGC AAAAAAAACTCGGATCTTTCCTCTCTTTTCATCAAATAGGAAGGGGCCAA
    Mapping_target: F57C7
    Type_of_mutation: Substitution: A C
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033304
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live: Curator_confirmed: WBPerson4025
  Affects: Gene: WBGene00200775
    Transcript: F57C7.12 VEP_consequence: non_coding_transcript_exon_variant
        VEP_impact: MODIFIER
        HGVSc: F57C7.12:n.14A>C
        cDNA_position: 14
        Exon_number: 1/1
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    This was suppressed because it overlapped with a corrected genome sequence error feature Feature_evidence: WBsf268355
    This was un-suppressed after examination showed it is not changed by the corrected genome sequence error Curator_confirmed: WBPerson4025
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele