WormBase Tree Display for Variation: WBVar00276570

WBVar00276570 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: gk1533
    Other_name: F44C4.3.1:c.-6A>C
    HGVSg: CHROMOSOME_V:g.6614706A>C
  Sequence_details: SMap: S_parent: Sequence: F44C4
    Flanking_sequences: CATTTGCTCTATCTTGCTATTTGCTCTTTT CAAAAATGGTAAGTGGTTGTTTTAGCGTGA
    Mapping_target: F44C4
    Type_of_mutation: Substitution: A C
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00036969
    Laboratory: VC
    Person: WBPerson427
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00000784
    Transcript: F44C4.3.1 VEP_consequence: 5_prime_UTR_variant
        VEP_impact: MODIFIER
        HGVSc: F44C4.3.1:c.-6A>C
        cDNA_position: 33
        Exon_number: 1/4
  Isolation: Mutagen: EMS
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele