WormBase Tree Display for Variation: WBVar00276456
expand all nodes | collapse all nodes | view schema
WBVar00276456 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk2123 | |||
Other_name | CE53407:p.Ser533Phe | ||||
F31A3.5.2:c.1598C>T | |||||
F31A3.5.1:c.1598C>T | |||||
HGVSg | CHROMOSOME_X:g.17556398G>A | ||||
Sequence_details | SMap | S_parent | Sequence | F31A3 | |
Flanking_sequences | CAAGAGTCCATGCTCCGGCTCATTGCATCA | ACGCTGTGGCGTGAGGGATGGGGACCCCAG | |||
Mapping_target | F31A3 | ||||
Type_of_mutation | Substitution | G | A | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00036970 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00017939 | |||
Transcript | F31A3.5.1 | VEP_consequence | missense_variant | ||
VEP_impact | MODERATE | ||||
HGVSc | F31A3.5.1:c.1598C>T | ||||
HGVSp | CE53407:p.Ser533Phe | ||||
cDNA_position | 1712 | ||||
CDS_position | 1598 | ||||
Protein_position | 533 | ||||
Exon_number | 12/14 | ||||
Codon_change | tCt/tTt | ||||
Amino_acid_change | S/F | ||||
F31A3.5.2 | VEP_consequence | missense_variant | |||
VEP_impact | MODERATE | ||||
HGVSc | F31A3.5.2:c.1598C>T | ||||
HGVSp | CE53407:p.Ser533Phe | ||||
cDNA_position | 1655 | ||||
CDS_position | 1598 | ||||
Protein_position | 533 | ||||
Exon_number | 11/13 | ||||
Codon_change | tCt/tTt | ||||
Amino_acid_change | S/F | ||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |