WormBase Tree Display for Variation: WBVar00276228

WBVar00276228 Evidence: Paper_evidence: WBPaper00036200
  Name: Public_name: ok5364
    Other_name: F01D4.1b.1:c.174+151C>T
    HGVSg: CHROMOSOME_IV:g.10464983C>T
  Sequence_details: SMap: S_parent: Sequence: F01D4
    Flanking_sequences: TTGAGATCAATTCAATGTCTTTGACAGACT CTCCCAGATTACACACACACATAATAAAAT
    Mapping_target: F01D4
    Type_of_mutation: Substitution: C T
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00033305
    Laboratory: RB
    Person: WBPerson46
    Analysis: Million_Mutation_Pilot_Project
    KO_consortium_allele
    Status: Live
  Affects: Gene: WBGene00008485
    Transcript: F01D4.1b.1 VEP_consequence: intron_variant
        VEP_impact: MODIFIER
        HGVSc: F01D4.1b.1:c.174+151C>T
        Intron_number: 2/7
  Isolation: Mutagen: ENU
  Reference: WBPaper00036200
  Remark: Allele identified through whole-genome sequencing by the Gene Knockout Consortium Paper_evidence: WBPaper00036200
    Sequenced by the C. elegans Gene Knockout Consortium Paper_evidence: WBPaper00041807
  Method: KO_consortium_allele