WormBase Tree Display for Variation: WBVar00276078
expand all nodes | collapse all nodes | view schema
WBVar00276078 | Evidence | Paper_evidence | WBPaper00036200 | ||
---|---|---|---|---|---|
Name | Public_name | gk939 | |||
Other_name | C46F11.1b.1:c.491G>A | ||||
C46F11.1a.1:c.506G>A | |||||
CE30906:p.Gly169Asp | |||||
CE37957:p.Gly164Asp | |||||
HGVSg | CHROMOSOME_III:g.3645184G>A | ||||
Sequence_details | SMap | S_parent | Sequence | C46F11 | |
Flanking_sequences | ACGATCATTTCGAACTTCCCACTGAAACAG | CCGTGTTCCAGAATATGATCATTTTTGCCC | |||
Mapping_target | C46F11 | ||||
Type_of_mutation | Substitution | G | A | ||
SeqStatus | Sequenced | ||||
Variation_type | Allele | ||||
Origin | Species | Caenorhabditis elegans | |||
Strain | WBStrain00036970 | ||||
Laboratory | VC | ||||
Person | WBPerson427 | ||||
Analysis | Million_Mutation_Pilot_Project | ||||
KO_consortium_allele | |||||
Status | Live | ||||
Affects | Gene | WBGene00006822 | |||
Transcript | C46F11.1b.1 (12) | ||||
C46F11.1a.1 (12) | |||||
Isolation | Mutagen | EMS | |||
Reference | WBPaper00036200 | ||||
Remark | Allele identified through whole-genome sequencing by the Gene Knockout Consortium | Paper_evidence | WBPaper00036200 | ||
Allele confirmed by Sanger sequencing | |||||
Sequenced by the C. elegans Gene Knockout Consortium | Paper_evidence | WBPaper00041807 | |||
Method | KO_consortium_allele |