WormBase Tree Display for Variation: WBVar00275496
expand all nodes | collapse all nodes | view schema
WBVar00275496 | Evidence | Paper_evidence | WBPaper00005082 | ||||||
---|---|---|---|---|---|---|---|---|---|
Name | Public_name | zu147 | |||||||
Other_name (2) | |||||||||
HGVSg | CHROMOSOME_I:g.9232343G>A | ||||||||
Sequence_details | SMap | S_parent | Sequence | VF36H2L | |||||
Flanking_sequences | ataacggatgcagtcactttaaaacaagtg | gaacattaattgaagaacgaaaattgagga | |||||||
Mapping_target | VF36H2L | ||||||||
Type_of_mutation | Substitution | c | t | ||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Laboratory | JJ | ||||||||
Status | Live | ||||||||
Affects | Gene | WBGene00000147 | |||||||
Transcript | VF36H2L.1.1 | VEP_consequence | stop_gained | ||||||
VEP_impact | HIGH | ||||||||
HGVSc | VF36H2L.1.1:c.826C>T | ||||||||
HGVSp | CE16526:p.Arg276Ter | ||||||||
cDNA_position | 829 | ||||||||
CDS_position | 826 | ||||||||
Protein_position | 276 | ||||||||
Exon_number | 5/6 | ||||||||
Codon_change | Cga/Tga | ||||||||
Amino_acid_change | R/* | ||||||||
Interactor | WBInteraction000521730 | ||||||||
WBInteraction000521733 | |||||||||
WBInteraction000521897 | |||||||||
WBInteraction000521898 | |||||||||
WBInteraction000521916 | |||||||||
WBInteraction000521917 | |||||||||
WBInteraction000521918 | |||||||||
WBInteraction000524376 | |||||||||
Genetics | Interpolated_map_position | I | 3.67828 | ||||||
Description | Phenotype | WBPhenotype:0000050 | Paper_evidence | WBPaper00005082 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Penetrance | High | Paper_evidence | WBPaper00005082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Range | 96 | 96 | Paper_evidence | WBPaper00005082 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00005082 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005082 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | |||||||||
WBPhenotype:0000052 | Paper_evidence | WBPaper00040544 | |||||||
Person_evidence | WBPerson261 | ||||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | weaker allele than zu123 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
The partial loss-of-function allele aph-1(zu147) causes an incompletely penetrant maternal-effect embryonic lethality: almost all progeny produced by an aph-1(zu147) hermaphrodite arrest as late-stage embryos or hatchling. | Paper_evidence | WBPaper00040544 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00040544 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Maternal | With_maternal_effect | Paper_evidence | WBPaper00040544 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0000080 | Paper_evidence | WBPaper00005082 | |||||||
WBPaper00040544 | |||||||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPerson712 | |||||||||
Remark | Mutants have a partial pharynx as evident from their morphology | Paper_evidence | WBPaper00005082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Almost all progeny produced by an aph-1(zu147) hermaphrodite arrest as late-stage embryos or hatchlings with the hallmark Notch phenotype of a missing anterior pharynx. | Paper_evidence | WBPaper00040544 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Incomplete | Paper_evidence | WBPaper00040544 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Recessive | Paper_evidence | WBPaper00005082 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003681 | PATO:0000460 | Paper_evidence | WBPaper00005082 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage (2) | |||||||||
Maternal | With_maternal_effect | Paper_evidence | WBPaper00040544 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001643 | Paper_evidence | WBPaper00005082 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | aph-1 embryos have super-numerary hypodermal cells. | Paper_evidence | WBPaper00005082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00005082 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00005082 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0005733 | PATO:0000460 | Paper_evidence | WBPaper00005082 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
Life_stage | WBls:0000003 | PATO:0000460 | Paper_evidence | WBPaper00005082 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Maternal | |||||||||
Phenotype_assay | Genotype | jcIs1 (jam-1::GFP) | Paper_evidence | WBPaper00005082 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Reference | WBPaper00040544 | ||||||||
WBPaper00005082 | |||||||||
WBPaper00026132 | |||||||||
Method | Substitution_allele |