WormBase Tree Display for Variation: WBVar00275456
expand all nodes | collapse all nodes | view schema
| WBVar00275456 | Evidence | Paper_evidence | WBPaper00005036 | ||||
|---|---|---|---|---|---|---|---|
| Name | Public_name | zc14 | |||||
| Other_name | CE45635:p.Gly381Arg | ||||||
| CE35836:p.Gly723Arg | |||||||
| C41C4.4a.1:c.2167G>A | |||||||
| C41C4.4b.1:c.1141G>A | |||||||
| HGVSg | CHROMOSOME_II:g.8113556C>T | ||||||
| Sequence_details | SMap | S_parent | Sequence | C41C4 | |||
| Flanking_sequences | tatgtgttaacctcgggtactcatcctttt | gaaaatcattgcacagacaagcaaatattg | |||||
| Mapping_target | C41C4 | ||||||
| Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00005036 | ||
| Author_evidence | Andrew Murley | ||||||
| Laboratory_evidence | AGD | ||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Strain | WBStrain00034062 | ||||||
| Laboratory | SJ | ||||||
| Status | Live | ||||||
| Affects (3) | |||||||
| Genetics | Interpolated_map_position | II | 0.679673 | ||||
| Description | Phenotype (9) | ||||||
| Phenotype_not_observed | WBPhenotype:0001653 | Paper_evidence | WBPaper00005432 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Mutant animals tolerated cadmium exposure for extended periods of time. | Paper_evidence | WBPaper00005432 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| WBPhenotype:0002423 | Paper_evidence | WBPaper00037064 | |||||
| Curator_confirmed | WBPerson2987 | ||||||
| Remark | "HP (hypoxic preconditioning) consistently provided protection from subsequent harsh hypoxic exposure for wild-type animals (Fig. 4A and B)... unlike the case for Tm preconditioning, ire-1(zc14), a missense mutation in the kinase domain that is thought to abolish the XBP-1 endonuclease activity of IRE-1 and behaves as a reduction-of-function allele (Fig. 3B) (8), did not block HP (Fig. 4C)." | Paper_evidence | WBPaper00037064 | ||||
| Curator_confirmed | WBPerson2987 | ||||||
| Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00037064 | ||||
| Curator_confirmed | WBPerson2987 | ||||||
| Reference | WBPaper00040397 | ||||||
| WBPaper00032521 | |||||||
| WBPaper00037064 | |||||||
| WBPaper00005036 | |||||||
| WBPaper00005432 | |||||||
| WBPaper00030999 | |||||||
| WBPaper00049705 | |||||||
| WBPaper00050679 | |||||||
| WBPaper00065802 | |||||||
| Remark | Updated the mutation to G->A rather than the originally reported G->C based on new sequencing data. | Curator_confirmed | WBPerson1983 | ||||
| Method | Substitution_allele |
