WormBase Tree Display for Variation: WBVar00275450
expand all nodes | collapse all nodes | view schema
WBVar00275450 | Name | Public_name | yz6 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | y26 | Paper_evidence | WBPaper00033168 | |||||
B0212.5.1:c.974G>A | ||||||||
CE20445:p.Trp325Ter | ||||||||
HGVSg | CHROMOSOME_IV:g.3555543C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | B0212 | ||||
Flanking_sequences | aaatgctggagattatgaaggtggagttct | gaggttctcggatatgacgtgctccgcata | ||||||
Mapping_target | B0212 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00024918 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00023453 | |||||||
Laboratory | JY | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00003889 | ||||||
Transcript | B0212.5.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | B0212.5.1:c.974G>A | |||||||
HGVSp | CE20445:p.Trp325Ter | |||||||
cDNA_position | 974 | |||||||
CDS_position | 974 | |||||||
Protein_position | 325 | |||||||
Exon_number | 6/15 | |||||||
Codon_change | tGg/tAg | |||||||
Amino_acid_change | W/* | |||||||
Genetics | Interpolated_map_position | IV | -3.15579 | |||||
Description | Phenotype | WBPhenotype:0002378 | Paper_evidence | WBPaper00058803 | ||||
Curator_confirmed | WBPerson36360 | |||||||
Phenotype_not_observed | WBPhenotype:0001842 | Paper_evidence | WBPaper00033168 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Similar to N2, Trifluoperazine produced a significant rebound response in the osm-9 mutants | Paper_evidence | WBPaper00033168 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Probable_null_via_phenotype | Paper_evidence | WBPaper00033168 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | trifluoperazine (40 uM) | Paper_evidence | WBPaper00033168 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00023954 | |||||||
WBPaper00033168 | ||||||||
WBPaper00019327 | ||||||||
WBPaper00026130 | ||||||||
WBPaper00058803 | ||||||||
Remark | This allele has erroneously been referred to as "y26". | Paper_evidence | WBPaper00033168 | |||||
Method | Substitution_allele |