WormBase Tree Display for Variation: WBVar00275340
expand all nodes | collapse all nodes | view schema
WBVar00275340 | Evidence | Paper_evidence | WBPaper00002918 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | y251 | ||||||
Other_name | CE23555:p.Gly94Glu | |||||||
C18A3.6b.1:c.239G>A | ||||||||
CE20518:p.Gly80Glu | ||||||||
C18A3.6a.1:c.281G>A | ||||||||
HGVSg | CHROMOSOME_II:g.5723123C>T | |||||||
Sequence_details | SMap | S_parent | Sequence | C18A3 | ||||
Flanking_sequences | gagtcaaacttcaaatctgggataccgccg | acaggagaggtaccgtaccatcaccaccgc | ||||||
Mapping_target | C18A3 | |||||||
Type_of_mutation | Substitution | g | a | Paper_evidence | WBPaper00002918 | |||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00029039 | |||||||
WBStrain00040624 | ||||||||
Laboratory | TY | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00004267 | ||||||
Transcript | C18A3.6a.1 (12) | |||||||
C18A3.6b.1 (12) | ||||||||
Genetics | Interpolated_map_position | II | -0.959197 | |||||
Mapping_data | In_multi_point | 3346 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Person_evidence | WBPerson261 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | similar to y250 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000017 | Paper_evidence | WBPaper00035198 | ||||||
Person_evidence | WBPerson261 | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | similar to y250 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00003650 | Paper_evidence | WBPaper00035198 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000273 | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibit reduced thrashing compared to wild type animals. | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000631 | Paper_evidence | WBPaper00035198 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals exhibit anterior convulsions when treated with pentylenetetrazole(PTZ). | Paper_evidence | WBPaper00035198 | |||||
Curator_confirmed | WBPerson712 | |||||||
Affected_by | Molecule | WBMol:00004251 | Paper_evidence | WBPaper00035198 | ||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000643 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | similar to y250 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001434 | Person_evidence | WBPerson261 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | similar to y250 | Person_evidence | WBPerson261 | |||||
Curator_confirmed | WBPerson712 | |||||||
Disease_info | Models_disease | DOID:1826 | ||||||
Models_disease_in_annotation | WBDOannot00000559 | |||||||
Reference | WBPaper00035198 | |||||||
WBPaper00014765 | ||||||||
WBPaper00014764 | ||||||||
WBPaper00022070 | ||||||||
Method | Substitution_allele |