WormBase Tree Display for Variation: WBVar00275299
expand all nodes | collapse all nodes | view schema
WBVar00275299 | Evidence | Paper_evidence | WBPaper00006355 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | y47 | ||||||
Other_name | CE26205:p.Gln1396Ter | |||||||
Y59A8B.1a.1:c.4186C>T | ||||||||
HGVSg | CHROMOSOME_V:g.17939620G>A | |||||||
Sequence_details | SMap | S_parent | Sequence | Y59A8B | ||||
Flanking_sequences | attatgccgtggggtgatttttcggaagtt | agggtataaaagaggacacttcggacgatg | ||||||
Mapping_target | Y59A8B | |||||||
Type_of_mutation | Substitution | c | t | |||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00035092 | |||||||
Laboratory | TY | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001080 | ||||||
Transcript | Y59A8B.1a.1 | VEP_consequence | stop_gained | |||||
VEP_impact | HIGH | |||||||
HGVSc | Y59A8B.1a.1:c.4186C>T | |||||||
HGVSp | CE26205:p.Gln1396Ter | |||||||
cDNA_position | 4351 | |||||||
CDS_position | 4186 | |||||||
Protein_position | 1396 | |||||||
Exon_number | 9/13 | |||||||
Codon_change | Cag/Tag | |||||||
Amino_acid_change | Q/* | |||||||
Interactor | WBInteraction000052067 | |||||||
WBInteraction000052434 | ||||||||
Genetics | Interpolated_map_position | V | 13.3321 | |||||
Mapping_data | In_pos_neg_data | 4305 | ||||||
Description | Phenotype | WBPhenotype:0000006 | Paper_evidence | WBPaper00001077 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Slightly Egl. | Paper_evidence | WBPaper00001077 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000066 | Paper_evidence | WBPaper00001077 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 85% XX viable. | Paper_evidence | WBPaper00001077 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000583 | Paper_evidence (2) | |||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | XX animals are dumpy. | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000718 | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | As determined by the penetrance of the lin-14(n179) mutant phenotype, based on the [# mutant seam cell nuclei (undivided seam cell nuclei + nuclei that generated precocious alae)/ total # seam cell nuclei] animals after the L3 molt. | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Treatment | Nomarski optics were used to follow the fates of the midbody seam cell nuclei of L3 animals raised at 24C. | Paper_evidence | WBPaper00001011 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 24 | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001581 | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Animals have 21%(n=20) mutant seam cell nuclei, similar to XXX lin-14 animals (26% n=25) and less mutant than XX lin-14 animals (77% n=40). | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | |||||||
EQ_annotations (2) | ||||||||
Phenotype_assay | Treatment | Nomarski optics were used to follow the fates of the midbody seam cell nuclei of L3 animals raised at 24C. | Paper_evidence | WBPaper00001011 | ||||
Curator_confirmed | WBPerson712 | |||||||
Temperature | 24 | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001582 | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | XO lin-14(n179) males display significantly more lin-14 seam cell defects than lin-14 animals alone but similar to levels observed for lin-14/Df animals. | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Temperature | 20 | Paper_evidence | WBPaper00001011 | ||||
Curator_confirmed | WBPerson712 | |||||||
Genotype | lin-14(n179) | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001583 | Paper_evidence | WBPaper00001011 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | XXX and XXXX progeny are lethal. | Paper_evidence | WBPaper00001011 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000065 | Paper_evidence | WBPaper00001077 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00013841 | |||||||
WBPaper00001077 | ||||||||
WBPaper00001011 | ||||||||
Method | Substitution_allele |