WormBase Tree Display for Variation: WBVar00275125
expand all nodes | collapse all nodes | view schema
| WBVar00275125 | Evidence | Paper_evidence | WBPaper00005233 | ||||||
|---|---|---|---|---|---|---|---|---|---|
| WBPaper00006282 | |||||||||
| Name | Public_name | wa22 | |||||||
| Other_name | W08D2.4a.1:c.557C>T | ||||||||
| CE48384:p.Ser85Phe | |||||||||
| W08D2.4d.1:c.254C>T | |||||||||
| CE25153:p.Ser186Phe | |||||||||
| HGVSg | CHROMOSOME_IV:g.9804771C>T | ||||||||
| Sequence_details | SMap | S_parent | Sequence | W08D2 | |||||
| Flanking_sequences | caaagaacagacctttgaatgatactattt | tttgttctttggtaatttcttacaaggatt | |||||||
| Mapping_target | W08D2 | ||||||||
| Type_of_mutation | Substitution | c | t | ||||||
| SeqStatus | Sequenced | ||||||||
| Variation_type | Allele | ||||||||
| Origin | Species | Caenorhabditis elegans | |||||||
| Strain | WBStrain00004012 | ||||||||
| Laboratory | BX | ||||||||
| Status | Live | ||||||||
| Affects | Gene | WBGene00001395 | |||||||
| Transcript | W08D2.4d.1 | VEP_consequence | missense_variant | ||||||
| VEP_impact | MODERATE | ||||||||
| HGVSc | W08D2.4d.1:c.254C>T | ||||||||
| HGVSp | CE48384:p.Ser85Phe | ||||||||
| cDNA_position | 254 | ||||||||
| CDS_position | 254 | ||||||||
| Protein_position | 85 | ||||||||
| Exon_number | 1/5 | ||||||||
| Codon_change | tCt/tTt | ||||||||
| Amino_acid_change | S/F | ||||||||
| W08D2.4a.1 | VEP_consequence | missense_variant | |||||||
| VEP_impact | MODERATE | ||||||||
| HGVSc | W08D2.4a.1:c.557C>T | ||||||||
| HGVSp | CE25153:p.Ser186Phe | ||||||||
| cDNA_position | 597 | ||||||||
| CDS_position | 557 | ||||||||
| Protein_position | 186 | ||||||||
| Exon_number | 4/9 | ||||||||
| Codon_change | tCt/tTt | ||||||||
| Amino_acid_change | S/F | ||||||||
| Interactor | WBInteraction000500599 | ||||||||
| WBInteraction000503417 | |||||||||
| Genetics | Interpolated_map_position | IV | 4.42125 | ||||||
| Description | Phenotype | WBPhenotype:0000031 | Paper_evidence | WBPaper00005233 | |||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Although fat-3 homozygotes are viable and fertile, they grow slowly, move sluggishly, and have a reduced brood size. In growth comparisons, authors found that after 3 days of growth at 20 degrees Celsius, staged embryos produced by fat-3 homozygous mothers had developed to L4 larval stage, whereas similar stage WT embryos had reached adulthood and were beginning to lay eggs (Fig. 3 A and D). The fat-3 animals required an additional day of development before commencing egg laying. | Paper_evidence | WBPaper00005233 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000138 | Paper_evidence | WBPaper00005233 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | fat-3 mutants displayed a modest increase in fatty acids 18:2n6 (9.1 vs. 5.4% in WT) and 18:3n3 (2 vs. 0.2% in WT). Homozygotes segregating from this population displayed a striking fatty acid composition, with only 1.0% 20:2n6 and 1.6% 20:3n3 and no other detectable C20 fatty acids (Fig. 3D, Table 1). The 18:2n6 increased to 12.7% and the 18:3n3 accumulated to 11.0%. | Paper_evidence | WBPaper00005233 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000154 | Paper_evidence | WBPaper00005233 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Although fat-3 homozygotes are viable and fertile, they grow slowly, move sluggishly, and have a reduced brood size. | Paper_evidence | WBPaper00005233 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000646 | Paper_evidence | WBPaper00005233 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | Although fat-3 homozygotes are viable and fertile, they grow slowly, move sluggishly, and have a reduced brood size. | Paper_evidence | WBPaper00005233 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0001720 | Paper_evidence | WBPaper00028527 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | In mutant hermaphrodites, sperm are often found throughout the uterus and near the vulva unlike wild-type. Many of these sperm are likely ejected into the external environment during egg laying, causing a reduction in fertilized egg production | Paper_evidence | WBPaper00028527 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00028527 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Wild-type males labelled with MitoTracker were mated to non-labelled mutant hermaphrodites or were subjected to DAPI staining | Paper_evidence | WBPaper00028527 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| WBPhenotype:0001823 | Paper_evidence | WBPaper00028527 | |||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Remark | Male sperm failed to accumulate in the spermatheca | Paper_evidence | WBPaper00028527 | ||||||
| Curator_confirmed | WBPerson2021 | ||||||||
| EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00028527 | ||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_assay | Treatment | Wild-type males labelled with MitoTracker were mated to non-labelled mutant hermaphrodites | Paper_evidence | WBPaper00028527 | |||||
| Curator_confirmed | WBPerson2021 | ||||||||
| Phenotype_not_observed | WBPhenotype:0000062 | Paper_evidence | WBPaper00005233 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | fat-3 homozygotes are viable. | Paper_evidence | WBPaper00005233 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| WBPhenotype:0000688 | Paper_evidence | WBPaper00005233 | |||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Remark | fat-3 homozygotes are fertile | Paper_evidence | WBPaper00005233 | ||||||
| Curator_confirmed | WBPerson2987 | ||||||||
| Disease_info | Models_disease | DOID:1574 | |||||||
| DOID:3146 | |||||||||
| Models_disease_in_annotation | WBDOannot00000699 | ||||||||
| WBDOannot00000845 | |||||||||
| Reference | WBPaper00005233 | ||||||||
| WBPaper00028527 | |||||||||
| Method | Substitution_allele |
