WormBase Tree Display for Variation: WBVar00275067
expand all nodes | collapse all nodes | view schema
WBVar00275067 | Evidence | Paper_evidence | WBPaper00004713 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | vs23 | ||||||
HGVSg | CHROMOSOME_I:g.7320159_7321429del | |||||||
Sequence_details | SMap | S_parent | Sequence | F52A8 | ||||
Flanking_sequences | tcctatttttgagcatgttcaacagaataa | atgggagctcttggtgtaaaacagcgtcga | ||||||
Mapping_target | F52A8 | |||||||
Type_of_mutation | Deletion | |||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | LX | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001680 | ||||||
Transcript | F52A8.2a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-332 | |||||||
CDS_position | ?-195 | |||||||
Protein_position | ?-65 | |||||||
Intron_number | 2-3/9 | |||||||
Exon_number | 1-4/10 | |||||||
Interactor | WBInteraction000504654 | |||||||
WBInteraction000517387 | ||||||||
Isolation | Mutagen | TMP | Paper_evidence | WBPaper00004713 | ||||
Genetics | Interpolated_map_position | I | 1.91103 | |||||
Description | Phenotype | WBPhenotype:0000120 | Paper_evidence | WBPaper00035489 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutations in GPB-2/G5 resulted in the reduction of both EGL-10 and EAT-16 protein levels | Paper_evidence | WBPaper00035489 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_assay | Treatment | Western blots | Paper_evidence | WBPaper00035489 | ||||
Curator_confirmed | WBPerson2021 | |||||||
Phenotype_not_observed | WBPhenotype:0000640 | Paper_evidence | WBPaper00035489 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | Mutations in GPB-2/G5 resulted in animals whose egg laying more closely resembled that of wild-type animals | Paper_evidence | WBPaper00035489 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00035489 | |||||||
Remark | vs23 is a deletion of 1271 bp [030411 ck1] | |||||||
Method | Deletion_allele |