WormBase Tree Display for Variation: WBVar00275044
expand all nodes | collapse all nodes | view schema
WBVar00275044 | Evidence | Paper_evidence | WBPaper00005908 | |||||
---|---|---|---|---|---|---|---|---|
Name | Public_name | ve18 | ||||||
Other_name | F13D11.2b.1:c.47_47+4del | |||||||
F13D11.2a.1:c.113_113+4del | ||||||||
HGVSg | CHROMOSOME_X:g.5823178_5823182del | |||||||
Sequence_details | SMap | S_parent | Sequence | F13D11 | ||||
Flanking_sequences | gcaattttgtgtcaaaaacacctttaatag | gttgatttgacacttattttcttaactgca | ||||||
Mapping_target | F13D11 | |||||||
Type_of_mutation | Deletion | ggtga | ||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00033325 | |||||||
WBStrain00040231 | ||||||||
Laboratory | RG | |||||||
Status | Live | |||||||
Affects | Gene | WBGene00001824 | ||||||
Transcript | F13D11.2a.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | F13D11.2a.1:c.113_113+4del | |||||||
cDNA_position | 248-? | |||||||
CDS_position | 113-? | |||||||
Protein_position | 38-? | |||||||
Intron_number | 3/9 | |||||||
Exon_number | 3/10 | |||||||
F13D11.2b.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | F13D11.2b.1:c.47_47+4del | |||||||
cDNA_position | 47-? | |||||||
CDS_position | 47-? | |||||||
Protein_position | 16-? | |||||||
Intron_number | 1/6 | |||||||
Exon_number | 1/7 | |||||||
Interactor (13) | ||||||||
Genetics | Interpolated_map_position | X | -4.27076 | |||||
Mapping_data | In_multi_point | 4396 | ||||||
Description | Phenotype | WBPhenotype:0000033 | Paper_evidence | WBPaper00036739 | ||||
Curator_confirmed | WBPerson3490 | |||||||
WBPhenotype:0000134 | Paper_evidence | WBPaper00036739 | ||||||
Curator_confirmed | WBPerson3490 | |||||||
WBPhenotype:0000135 | Paper_evidence | WBPaper00036739 | ||||||
Curator_confirmed | WBPerson3490 | |||||||
WBPhenotype:0000167 | Paper_evidence | WBPaper00036739 | ||||||
Curator_confirmed | WBPerson3490 | |||||||
WBPhenotype:0000170 | Paper_evidence | WBPaper00036739 | ||||||
Curator_confirmed | WBPerson3490 | |||||||
WBPhenotype:0000202 | Paper_evidence | WBPaper00035486 | ||||||
Curator_confirmed | WBPerson3490 | |||||||
Phenotype_assay | Genotype | apl-1::gfp::unc-54(3'UTR) | Paper_evidence | WBPaper00035486 | ||||
Curator_confirmed | WBPerson3490 | |||||||
WBPhenotype:0002232 | Paper_evidence | WBPaper00040787 | ||||||
Curator_confirmed | WBPerson7245 | |||||||
Remark | Fig 4, DD neurons have delayed synapse remodeling | Paper_evidence | WBPaper00040787 | |||||
Curator_confirmed | WBPerson7245 | |||||||
Phenotype_not_observed | WBPhenotype:0000039 | Paper_evidence | WBPaper00037672 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | hbl-1 does not affect lifespan. | Paper_evidence | WBPaper00037672 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000637 | Paper_evidence | WBPaper00037672 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | A convincing hbl-1 Daf-c phenotype was not observed in the absence of daf-7 and daf-2 alleles, even in animals sensitized for dauer formation by the addition of daumone (Jeong et al. 2005) to the growth medium. | Paper_evidence | WBPaper00037672 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00040787 | |||||||
WBPaper00037672 | ||||||||
WBPaper00036739 | ||||||||
WBPaper00005908 | ||||||||
WBPaper00018451 | ||||||||
WBPaper00019005 | ||||||||
WBPaper00026183 | ||||||||
WBPaper00035486 | ||||||||
Method | Deletion_allele |