WormBase Tree Display for Variation: WBVar00252427

WBVar00252427 Name: Public_name: tm3828
    Other_name: F59E12.11.2:c.197_297del
      CE28570:p.Leu66CysfsTer11
      F59E12.11.1:c.197_297del
    HGVSg: CHROMOSOME_II:g.5648732_5648878del
  Sequence_details: SMap: S_parent: Sequence: F59E12
    Flanking_sequences: aacggcaaaatgttcttgtaatcgtgttgc aaaaacggggaatttcggtgaatcttttgt
    Mapping_target: F59E12
    Source_location: 7 CHROMOSOME_II 5648731 5648879 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm3828_external
      tm3828_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 3828
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00019126
      WBGene00302971
    Transcript: F59E12.17.1 VEP_consequence: 3_prime_UTR_variant
        VEP_impact: MODIFIER
        cDNA_position: 472-?
        Exon_number: 5/5
      F59E12.11.2 (11)
      F59E12.11.1 (11)
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Reference: WBPaper00064980
  Remark: 31298/31299-31445/31446 (147 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele