WormBase Tree Display for Variation: WBVar00251878
expand all nodes | collapse all nodes | view schema
| WBVar00251878 | Name | Public_name | tm3100 | |||||
|---|---|---|---|---|---|---|---|---|
| Other_name | CE46403:p.Met80Ter | |||||||
| C09G5.8a.1:c.238_644del | ||||||||
| HGVSg | CHROMOSOME_II:g.10721059_10721598del | |||||||
| Sequence_details | SMap | S_parent | Sequence | C09G5 | ||||
| Flanking_sequences | gatgtggtgaaagaaaatcagattcttgat | taatgacggtgaaggaaaagactcagaact | ||||||
| Mapping_target | C09G5 | |||||||
| Source_location | 7 | CHROMOSOME_II | 10721058 | 10721599 | Inferred_automatically | National_Bioresource_Project | ||
| Type_of_mutation | Deletion | |||||||
| PCR_product | tm3100_external | |||||||
| tm3100_internal | ||||||||
| SeqStatus | Sequenced | |||||||
| Variation_type | Allele | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Component_of_genotype | WBGenotype00000025 | |||||||
| Laboratory | FX | |||||||
| Author | Mitani S | |||||||
| DB_info | Database | National_Bioresource_Project | seq | 3100 | ||||
| NBP_allele | ||||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00007490 | ||||||
| Transcript | C09G5.8a.1 (11) | |||||||
| Isolation | Mutagen | TMP/UV | ||||||
| Genetics | Map | II | ||||||
| Description | Phenotype | WBPhenotype:0000436 | Paper_evidence | WBPaper00060242 | ||||
| Curator_confirmed | WBPerson291 | |||||||
| Phenotype_not_observed | WBPhenotype:0000031 | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Comment to the NBP from Dr. K. Ashrafi: non-Gro. | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Laboratory_evidence | KQ | |||||||
| WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Laboratory_evidence | FX | |||||||
| WBPhenotype:0002535 | Person_evidence | WBPerson7743 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Comment to the National Bioresource Project of Japan from Dr. O. Blacque: Dyf ( ). | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Laboratory_evidence | OEB | |||||||
| Reference | WBPaper00060242 | |||||||
| Remark | 26722/26723-27262/27263 (540 bp deletion) | |||||||
| This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
| Method | NBP_knockout_allele |
