WormBase Tree Display for Variation: WBVar00251377
expand all nodes | collapse all nodes | view schema
WBVar00251377 | Name | Public_name | tm2503 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE01774:p.Leu58ArgfsTer31 | |||||||
C09F5.2b.1:c.173_659del | ||||||||
C09F5.2a.1:c.300-185_671del | ||||||||
C09F5.2a.2:c.300-185_671del | ||||||||
HGVSg | CHROMOSOME_III:g.653069_653697del | |||||||
Sequence_details | SMap | S_parent | Sequence | C09F5 | ||||
Flanking_sequences | taactccttatccgttacctcagtttttcc | gttcacggcagtcggttatccaactgcagg | ||||||
Mapping_target | C09F5 | |||||||
Source_location | 7 | CHROMOSOME_III | 653068 | 653698 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm2503_external | |||||||
tm2503_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2503 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00015648 | ||||||
Transcript | C09F5.2a.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | C09F5.2a.2:c.300-185_671del | |||||||
cDNA_position | ?-898 | |||||||
CDS_position | ?-671 | |||||||
Protein_position | ?-224 | |||||||
Intron_number | 4-5/7 | |||||||
Exon_number | 5-6/8 | |||||||
C09F5.2a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | C09F5.2a.1:c.300-185_671del | |||||||
cDNA_position | ?-1169 | |||||||
CDS_position | ?-671 | |||||||
Protein_position | ?-224 | |||||||
Intron_number | 6-7/9 | |||||||
Exon_number | 7-8/10 | |||||||
C09F5.2b.1 (11) | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Oringally classified as lethal OR sterile by the National Bioresource Project of Japan. Comments to the NBP from Dr. Hongkyun Kim: not Let. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | HKK | |||||||
Remark | 2183/2184-2812/2813 (629 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |