WormBase Tree Display for Variation: WBVar00251350
expand all nodes | collapse all nodes | view schema
| WBVar00251350 | Name | Public_name | tm2466 | |||||
|---|---|---|---|---|---|---|---|---|
| Other_name | D2013.1.1:c.111_246del | |||||||
| CE30340:p.Phe37LeufsTer37 | ||||||||
| HGVSg | CHROMOSOME_II:g.9322611_9322799del | |||||||
| Sequence_details | SMap | S_parent | Sequence | D2013 | ||||
| Flanking_sequences | aacagaattccgatagtaggattttgtaat | aagtaccgtaaaagactagatttgccaact | ||||||
| Mapping_target | D2013 | |||||||
| Source_location | 7 | CHROMOSOME_II | 9322610 | 9322800 | Inferred_automatically | National_Bioresource_Project | ||
| Type_of_mutation | Deletion | |||||||
| PCR_product | tm2466_external | |||||||
| tm2466_internal | ||||||||
| SeqStatus | Sequenced | |||||||
| Variation_type | Allele | |||||||
| Origin | Species | Caenorhabditis elegans | ||||||
| Laboratory | FX | |||||||
| Author | Mitani S | |||||||
| DB_info | Database | National_Bioresource_Project | seq | 2466 | ||||
| NBP_allele | ||||||||
| Status | Live | |||||||
| Affects | Gene | WBGene00004286 | ||||||
| Transcript | D2013.1.1 (11) | |||||||
| Isolation | Mutagen | TMP/UV | ||||||
| Genetics | Map | II | ||||||
| Description | Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Laboratory_evidence | FX | |||||||
| WBPhenotype:0001686 | Person_evidence | WBPerson7743 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Comment to the National Bioresource Project of Japan from Dr. S. Eimer: does not affect levamisole receptor trafficking. | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Laboratory_evidence | GQ | |||||||
| Affected_by | Molecule | WBMol:00004019 | Person_evidence | WBPerson7743 | ||||
| Curator_confirmed | WBPerson712 | |||||||
| WBPhenotype:0002535 | Person_evidence | WBPerson7743 | ||||||
| Curator_confirmed | WBPerson712 | |||||||
| Remark | Comments to the National Bioresource Project of Japan: Dr. O. Blacque: dye-filling normal. | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson712 | |||||||
| Laboratory_evidence | OEB | |||||||
| Remark | 23001/23002-23190/23191 (189 bp deletion) | |||||||
| This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
| Method | NBP_knockout_allele |
