WormBase Tree Display for Variation: WBVar00251286
expand all nodes | collapse all nodes | view schema
WBVar00251286 | Name | Public_name | tm2398 | |||||
---|---|---|---|---|---|---|---|---|
Other_name (2) | ||||||||
HGVSg | CHROMOSOME_V:g.10280590_10281039del | |||||||
Sequence_details | SMap | S_parent | Sequence | Y22F5A | ||||
Flanking_sequences | agttggctttgtctctccagaagtaccacc | agtgattccattattgttgagtccgttata | ||||||
Mapping_target | Y22F5A | |||||||
Source_location | 7 | CHROMOSOME_V | 10280589 | 10281040 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm2398_external | |||||||
tm2398_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2398 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00003091 | ||||||
Transcript | Y22F5A.5.1 (11) | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | V | ||||||
Description | Phenotype | WBPhenotype:0000738 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment to the NBP from Dr. M. Herman: life span change by some bacteria. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | KS | |||||||
WBPhenotype:0001013 | Paper_evidence | WBPaper00040209 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Knock-out mutations resulted in significantly reduced resistance measures during exposure to pathogenic Bt (Bacillus thuringiensis). | Paper_evidence | WBPaper00040209 | |||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000231 | Paper_evidence | WBPaper00040209 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | On pathogenic Bt, the mutants did not significantly differ from the wild-type. | Paper_evidence | WBPaper00040209 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000659 | Paper_evidence | WBPaper00040209 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | On pathogenic Bt, the mutants did not significantly differ from the wild-type. | Paper_evidence | WBPaper00040209 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000673 | Paper_evidence | WBPaper00040209 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | On pathogenic Bt, the mutants did not significantly differ from the wild-type. | Paper_evidence | WBPaper00040209 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001819 | Paper_evidence | WBPaper00040209 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Mutants did not suffer from a significantly higher infection load than N2. | Paper_evidence | WBPaper00040209 | |||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00040209 | |||||||
Remark | 26508/26509-26958/26959 (450 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |