WormBase Tree Display for Variation: WBVar00251159

WBVar00251159 Name: Public_name: tm2241
    Other_name: CE29155:p.Thr175SerfsTer8
      ZK1248.10.1:c.523_708delinsTCAAGTAT
    HGVSg: CHROMOSOME_II:g.5826448_5826677delinsATACTTGA
  Sequence_details: SMap: S_parent: Sequence: ZK1248
    Flanking_sequences: tcgaaaaggagcttctatactttgatcagc ttcagcgtctgtttcttcttcagttaggaa
    Mapping_target: ZK1248
    Source_location: 7 CHROMOSOME_II 5826447 5826678 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: ATACTTGA
      Deletion
    PCR_product: tm2241_external
      tm2241_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00031265
      WBStrain00047446
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 2241
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00022880
    Transcript: ZK1248.10.1 (11)
    Interactor: WBInteraction000521801
      WBInteraction000521803
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
  Description: Phenotype: WBPhenotype:0000103 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. H. Sawa to the National Bioresource Project of Japan: abnormally large gut granueles Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
    Phenotype_not_observed: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as homozygous viable by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000256 Paper_evidence: WBPaper00048972
        Curator_confirmed: WBPerson2987
        Remark: "The only GDI homologue in C_elegans, gdi-1, as well as rab-5 are essential genes, therefore we could not test whether loss of either of these genes suppresses gpa-3QL(syIs25). Instead, we tested whether mutations in the GEFs rabx-5 and rme-6 and the GAP tbc-2, which activate and inactivate RAB-5 respectively, are suppressors. Interestingly, rabx-5(ok1763); gpa-3QL(syIs25) animals are dye-filling, indicating that rabx-5(ok1763) is a suppressor of gpa-3QL(syIs25) (Fig 5A). Cilium length measurements showed that mutation of rabx-5 significantly restored cilium length in gpa-3QL(syIs25) animals (Fig 5C). Also rme-6(b1014), the other RAB-5 GEF, suppressed the gpa-3QL induced dye filling defect (Fig 5B). Mutation of the RAB-5 GAP, tbc-2 (tm2241), did not suppress the gpa-3QL dye filling defect (Fig 5A)." Paper_evidence: WBPaper00048972
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: gpa-3QL(syIs25) Paper_evidence: WBPaper00048972
              Curator_confirmed: WBPerson2987
      WBPhenotype:0000604 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. Y. Jin to the National Bioresource Project of Japan: no specific neuronal phenotype is found. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000623 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. Y. Jin to the National Bioresource Project of Japan: no specific neuronal phenotype is found. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
      WBPhenotype:0000679 Paper_evidence: WBPaper00048972
        Curator_confirmed: WBPerson2987
        Remark: "First, we analyzed whether GFP::RAB-5 localization was affected by mutation of its GEFs or GAP. Mutation of the RAB-5 GEF rme-6 resulted in increased GFP::RAB-5 levels, whereas mutation of rabx-5 only slightly affected GFP::RAB-5 levels, although quantification of the fluorescence intensities did not reveal a significant difference between wild type and rme-6 or rabx-5 animals (Fig 6B and 6C). Inactivation of the RAB-5 GAP in tbc-2(tm2241) animals did not affect GFP::RAB-5 levels (Fig 6B and 6C)." Paper_evidence: WBPaper00048972
            Curator_confirmed: WBPerson2987
        Phenotype_assay: Genotype: GFP::RAB-5 Paper_evidence: WBPaper00048972
              Curator_confirmed: WBPerson2987
      WBPhenotype:0001225 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Comment from Dr. H. Sawa to the National Bioresource Project of Japan: not Psa. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
  Reference: WBPaper00048972
    WBPaper00065031
  Remark: 16926/16927-ATACTTGA-17156/17157 (230 bp deletion + 8 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele