WormBase Tree Display for Variation: WBVar00251062
expand all nodes | collapse all nodes | view schema
WBVar00251062 | Name | Public_name | tm2123 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | ||||||||
Sequence_details | SMap | S_parent | Sequence | Y80D3A | ||||
Flanking_sequences | aatcgcaccttctcgcctccccgcctacct | gttctccgattctcagctttacgcgttgag | ||||||
Mapping_target | Y80D3A | |||||||
Source_location | 7 | CHROMOSOME_V | 18874050 | 18875661 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Insertion | TNCCGGTTCTAGTA | ||||||
Deletion | ||||||||
PCR_product | tm2123_external | |||||||
tm2123_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00026699 | |||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 2123 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00013583 | ||||||
WBGene00001258 | ||||||||
Transcript | Y80D3A.3.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-458 | |||||||
CDS_position | ?-458 | |||||||
Protein_position | ?-153 | |||||||
Intron_number | 1/2 | |||||||
Exon_number | 1-2/3 | |||||||
Y80D3A.2a.1 | VEP_consequence | intron_variant | ||||||
VEP_impact | MODIFIER | |||||||
Intron_number | 13/20 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | V | ||||||
Description | Phenotype (11) | |||||||
Phenotype_not_observed | WBPhenotype:0001646 | Paper_evidence | WBPaper00034727 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Remark | The number of pharyngeal cells in ceh-51 mutants was similar to that in wild type | Paper_evidence | WBPaper00034727 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Penetrance | Complete | Paper_evidence | WBPaper00034727 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Recessive | Paper_evidence | WBPaper00034727 | ||||||
Curator_confirmed | WBPerson2021 | |||||||
Variation_effect | Null | Paper_evidence | WBPaper00034727 | |||||
Curator_confirmed | WBPerson2021 | |||||||
Reference | WBPaper00034727 | |||||||
Remark | 18370/18371-TNCCGGTTCTAGTA-19980/19981 (1610 bp deletion + 14 bp insertion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |