WormBase Tree Display for Variation: WBVar00250903

WBVar00250903 Name: Public_name: tm1942
    HGVSg: CHROMOSOME_V:g.5584038_5584738del
  Sequence_details: SMap: S_parent: Sequence: CD4
    Flanking_sequences: ctcgagcactcggtttggaggtagcgagcc acacgaaattgaacgaaaattgcgaaaacg
    Mapping_target: CD4
    Source_location: 7 CHROMOSOME_V 5584037 5584739 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1942_external
      tm1942_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1942
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00003927
    Transcript: CD4.6.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant
        VEP_impact: HIGH
        cDNA_position: ?-260
        CDS_position: ?-251
        Protein_position: ?-84
        Intron_number: 2/6
        Exon_number: 1-3/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: V
    Mapping_data: In_multi_point: 5254
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 2129/2130-2830/2831 (701 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele