WormBase Tree Display for Variation: WBVar00250826
expand all nodes | collapse all nodes | view schema
WBVar00250826 | Name | Public_name | tm1863 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | B0041.2b.1:c.106-7_563del | |||||||
B0041.2d.1:c.106-7_563del | ||||||||
B0041.2f.1:c.106-7_563del | ||||||||
B0041.2e.1:c.106-7_563del | ||||||||
B0041.2a.1:c.-21-7_437del | ||||||||
HGVSg | CHROMOSOME_I:g.4655342_4656030del | |||||||
Sequence_details | SMap | S_parent | Sequence | B0041 | ||||
Flanking_sequences | ttggattctgttccataaaactcataacat | gccaccatatggacaacgtggaaataatca | ||||||
Mapping_target | B0041 | |||||||
Source_location | 7 | CHROMOSOME_I | 4655341 | 4656031 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1863_external | |||||||
tm1863_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Strain | WBStrain00054872 | |||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1863 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00015007 | ||||||
Transcript | B0041.2f.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | |||||
VEP_impact | HIGH | |||||||
HGVSc | B0041.2f.1:c.106-7_563del | |||||||
cDNA_position | ?-617 | |||||||
CDS_position | ?-563 | |||||||
Protein_position | ?-188 | |||||||
Intron_number | 3-4/10 | |||||||
Exon_number | 4-5/11 | |||||||
B0041.2d.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | B0041.2d.1:c.106-7_563del | |||||||
cDNA_position | ?-563 | |||||||
CDS_position | ?-563 | |||||||
Protein_position | ?-188 | |||||||
Intron_number | 2-3/8 | |||||||
Exon_number | 3-4/9 | |||||||
B0041.2c.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-464 | |||||||
CDS_position | ?-437 | |||||||
Protein_position | ?-146 | |||||||
Intron_number | 2/8 | |||||||
Exon_number | 1-3/9 | |||||||
B0041.2e.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | B0041.2e.1:c.106-7_563del | |||||||
cDNA_position | ?-617 | |||||||
CDS_position | ?-563 | |||||||
Protein_position | ?-188 | |||||||
Intron_number | 3-4/10 | |||||||
Exon_number | 4-5/11 | |||||||
B0041.2a.2 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-458 | |||||||
CDS_position | ?-437 | |||||||
Protein_position | ?-146 | |||||||
Intron_number | 2/8 | |||||||
Exon_number | 1-3/9 | |||||||
B0041.2a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | B0041.2a.1:c.-21-7_437del | |||||||
cDNA_position | ?-617 | |||||||
CDS_position | ?-437 | |||||||
Protein_position | ?-146 | |||||||
Intron_number | 2-4/10 | |||||||
Exon_number | 3-5/11 | |||||||
B0041.2g.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-460 | |||||||
CDS_position | ?-437 | |||||||
Protein_position | ?-146 | |||||||
Intron_number | 2/8 | |||||||
Exon_number | 1-3/9 | |||||||
B0041.2b.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
HGVSc | B0041.2b.1:c.106-7_563del | |||||||
cDNA_position | ?-623 | |||||||
CDS_position | ?-563 | |||||||
Protein_position | ?-188 | |||||||
Intron_number | 3-4/10 | |||||||
Exon_number | 4-5/11 | |||||||
Interactor | WBInteraction000520792 | |||||||
WBInteraction000521375 | ||||||||
WBInteraction000541261 | ||||||||
WBInteraction000541262 | ||||||||
WBInteraction000541263 | ||||||||
WBInteraction000541264 | ||||||||
WBInteraction000542499 | ||||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | I | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000030 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. M. Han to the National Bioresource Project of Japan: WT growth. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000202 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. M. Han to the National Bioresource Project of Japan: WT adult alae. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000315 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. M. Han to the National Bioresource Project of Japan: WT touch response. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000518 | Paper_evidence | WBPaper00031252 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | ain-2(tm1863) homozygous mutants displayed no discernable phenotype. | Paper_evidence | WBPaper00031252 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000699 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. M. Han to the National Bioresource Project of Japan: WT vulval development. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0001887 | Paper_evidence | WBPaper00031252 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Phenotype_assay | Genotype | scm::GFP | Paper_evidence | WBPaper00031252 | ||||
Curator_confirmed | WBPerson712 | |||||||
Reference | WBPaper00031252 | |||||||
Remark | 12204/12205-12893/12894 (689 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |