WormBase Tree Display for Variation: WBVar00250733
expand all nodes | collapse all nodes | view schema
WBVar00250733 | Name | Public_name | tm1768 | ||||||
---|---|---|---|---|---|---|---|---|---|
Other_name | CE06191:p.Ile36_Ter128delinsLysLeuLeuLeuAlaLeu | ||||||||
M05B5.5a.1:c.107_384delinsAGCTGTTGTTGGCTTTA | |||||||||
HGVSg | CHROMOSOME_I:g.7193174_7193801delinsTAAAGCCAACAACAGCT | ||||||||
Sequence_details | SMap | S_parent | Sequence | C01H6 | |||||
Flanking_sequences | aacaatcgctgatgtttctgcagaattcgt | ttataaggataatcatatgcatttggaagc | |||||||
Mapping_target | C01H6 | ||||||||
Source_location | 7 | CHROMOSOME_I | 7193173 | 7193804 | Inferred_automatically | National_Bioresource_Project | |||
Type_of_mutation | Insertion | TAAAGCCAACAACAGCTTA | |||||||
Deletion | |||||||||
PCR_product | tm1768_external | ||||||||
tm1768_internal | |||||||||
SeqStatus | Sequenced | ||||||||
Variation_type | Allele | ||||||||
Origin | Species | Caenorhabditis elegans | |||||||
Strain | WBStrain00022642 | ||||||||
Laboratory | FX | ||||||||
Author | Mitani S | ||||||||
DB_info | Database | National_Bioresource_Project | seq | 1768 | |||||
NBP_allele | |||||||||
Status | Live | ||||||||
Affects (3) | |||||||||
Isolation | Mutagen | TMP/UV | |||||||
Genetics | Map | I | |||||||
Description | Phenotype | WBPhenotype:0000184 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Comment from Dr. B. Conradt to the National Bioresource Project of Japan: 3% NSM sister cell survival at 20C. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Laboratory_evidence | MD | ||||||||
Penetrance | Low | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Range | 3 | 3 | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson48 | ||||||||
EQ_annotations | Anatomy_term | WBbt:0003666 | PATO:0000460 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson48 | ||||||||
WBPhenotype:0000188 | Paper_evidence | WBPaper00033102 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Gonadal arms were short | Paper_evidence | WBPaper00033102 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00033102 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00033102 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00033102 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000396 | Paper_evidence | WBPaper00033102 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Gonad arms were not reflexed in most gonads | Paper_evidence | WBPaper00033102 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00033102 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00033102 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00033102 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000684 | Paper_evidence | WBPaper00033102 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | A dramatic reduction in germ cell number was observed when hlh-2(tm1768) mutants were shifted to 25 C | Paper_evidence | WBPaper00033102 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00033102 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00033102 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Treatment | DAPI staining | Paper_evidence | WBPaper00033102 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000688 | Paper_evidence | WBPaper00039950 | |||||||
Person_evidence | WBPerson7743 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
Remark (2) | |||||||||
Temperature_sensitive | Heat_sensitive | 25 | Paper_evidence | WBPaper00039950 | |||||
Person_evidence | WBPerson7743 | ||||||||
Curator_confirmed | WBPerson48 | ||||||||
WBPerson712 | |||||||||
WBPhenotype:0000690 | Paper_evidence | WBPaper00033102 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | This allele exhibited recessive defects in hermaphrodite gonad arm migration (data not shown) | Paper_evidence | WBPaper00033102 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Recessive | Paper_evidence | WBPaper00033102 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00033102 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00033102 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0000893 | Paper_evidence | WBPaper00033102 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | The hlh-2(tm1768) males had a significantly smaller germline mitotic region than controls | Paper_evidence | WBPaper00033102 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00033102 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00033102 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
WBPhenotype:0001652 | Paper_evidence | WBPaper00039950 | |||||||
Curator_confirmed | WBPerson712 | ||||||||
Remark | Animals exhibit a significant, 5%, defect in AC invasion at the P6.p four-cell stage. hlh-2(tm1768) animals with zero or299 two ACs were not observed. Defect is not stronger at higher temperatures. | Paper_evidence | WBPaper00039950 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
Penetrance | Low | Paper_evidence | WBPaper00039950 | ||||||
Curator_confirmed | WBPerson712 | ||||||||
WBPhenotype:0001656 | Paper_evidence | WBPaper00033102 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Remark | Weakly dominant defects in hermaphrodite DTC specification. hlh-2 (tm1768 +RNAi) mutants at 25C show more severe DTC loss in hermaphrodites and linker cell loss in males as indicated by lag-2 and ceh-22 reporters | Paper_evidence | WBPaper00033102 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Semi_dominant | Paper_evidence | WBPaper00033102 | |||||||
Curator_confirmed | WBPerson2021 | ||||||||
Variation_effect | Hypomorph_reduction_of_function | Paper_evidence | WBPaper00033102 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
EQ_annotations | Life_stage | WBls:0000057 | PATO:0000460 | Paper_evidence | WBPaper00033102 | ||||
Curator_confirmed | WBPerson2021 | ||||||||
WBls:0000056 | PATO:0000460 | Paper_evidence | WBPaper00033102 | ||||||
Curator_confirmed | WBPerson2021 | ||||||||
Temperature_sensitive | Heat_sensitive | 25C | Paper_evidence | WBPaper00033102 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_assay | Genotype | qIs57[lag-2::GFP] , qIs56[lag-2::GFP], qIs90[ceh- 22b::VENUS] | Paper_evidence | WBPaper00033102 | |||||
Curator_confirmed | WBPerson2021 | ||||||||
Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson48 | ||||||||
Laboratory_evidence | FX | ||||||||
Reference | WBPaper00039950 | ||||||||
WBPaper00033102 | |||||||||
Remark (2) | |||||||||
Method | NBP_knockout_allele |