WormBase Tree Display for Variation: WBVar00250724
expand all nodes | collapse all nodes | view schema
WBVar00250724 | Name | Public_name | tm1759 | |||||
---|---|---|---|---|---|---|---|---|
Other_name | CE43083:p.Ala32LeufsTer79 | |||||||
F57F5.1.1:c.93_552del | ||||||||
HGVSg | CHROMOSOME_V:g.12003322_12003877del | |||||||
Sequence_details | SMap | S_parent | Sequence | F57F5 | ||||
Flanking_sequences | ggttaagcacggagatgccattccagttga | gttaccggaggatcttatcaagataagact | ||||||
Mapping_target | F57F5 | |||||||
Source_location | 7 | CHROMOSOME_V | 12003321 | 12003878 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1759_external | |||||||
tm1759_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1759 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00010204 | ||||||
Transcript | F57F5.1.1 (11) | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | V | ||||||
Description | Phenotype_not_observed | WBPhenotype:0000050 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. M. Han to the National Bioresource Project of Japan: not embryonic lethal. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as homozygous viable by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
WBPhenotype:0000886 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comment from Dr. M. Han to the National Bioresource Project of Japan: WT. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Remark | 6346/6347-6902/6903 (556 bp deletion) | |||||||
This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. | Paper_evidence | WBPaper00041807 | ||||||
Method | NBP_knockout_allele |