WormBase Tree Display for Variation: WBVar00250712

WBVar00250712 Name: Public_name: tm1747
    Other_name: C17E4.9a.1:c.153+14_551del
    HGVSg: CHROMOSOME_I:g.9431521_9432041del
  Sequence_details: SMap: S_parent: Sequence: C17E4
    Flanking_sequences: gaaagtcttggttccaggtaatattttcaa caagtctggaaagccatgcgtcattatttc
    Mapping_target: C17E4
    Source_location: 7 CHROMOSOME_I 9431520 9432042 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Deletion
    PCR_product: tm1747_external
      tm1747_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1747
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00007646
      WBGene00170117
    Transcript: C17E4.13
      C17E4.9a.1 VEP_consequence: splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,intron_variant
        VEP_impact: HIGH
        HGVSc: C17E4.9a.1:c.153+14_551del
        cDNA_position: ?-609
        CDS_position: ?-551
        Protein_position: ?-184
        Intron_number: 3-4/6
        Exon_number: 4-5/7
  Isolation: Mutagen: TMP/UV
  Genetics: Map: I
  Description: Phenotype: WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson712
        Remark: Classified as lethal OR sterile by the National Bioresource Project of Japan. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson712
            Laboratory_evidence: FX
  Remark: 26525/26526-27046/27047 (521 bp deletion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
  Method: NBP_knockout_allele