WormBase Tree Display for Variation: WBVar00250621
expand all nodes | collapse all nodes | view schema
WBVar00250621 | Name | Public_name | tm1642 | |||||
---|---|---|---|---|---|---|---|---|
HGVSg | CHROMOSOME_III:g.5697189_5697618del | |||||||
Sequence_details | SMap | S_parent | Sequence | B0336 | ||||
Flanking_sequences | ctgctcgaccggctcaatatccttttcata | acatcgggatagcgtctgaaaatttgattt | ||||||
Mapping_target | B0336 | |||||||
Source_location | 7 | CHROMOSOME_III | 5697188 | 5697619 | Inferred_automatically | National_Bioresource_Project | ||
Type_of_mutation | Deletion | |||||||
PCR_product | tm1642_external | |||||||
tm1642_internal | ||||||||
SeqStatus | Sequenced | |||||||
Variation_type | Allele | |||||||
Origin | Species | Caenorhabditis elegans | ||||||
Laboratory | FX | |||||||
Author | Mitani S | |||||||
DB_info | Database | National_Bioresource_Project | seq | 1642 | ||||
NBP_allele | ||||||||
Status | Live | |||||||
Affects | Gene | WBGene00002982 | ||||||
WBGene00015147 | ||||||||
Transcript | B0336.7b.1 | VEP_consequence | 5_prime_UTR_variant | |||||
VEP_impact | MODIFIER | |||||||
cDNA_position | ?-105 | |||||||
Exon_number | 1/7 | |||||||
B0336.8.1 | VEP_consequence | coding_sequence_variant,3_prime_UTR_variant | ||||||
VEP_impact | MODIFIER | |||||||
cDNA_position | 292-? | |||||||
CDS_position | 289-? | |||||||
Protein_position | 97-? | |||||||
Exon_number | 4-5/5 | |||||||
B0336.7a.1 | VEP_consequence | splice_acceptor_variant,splice_donor_variant,coding_sequence_variant,5_prime_UTR_variant,intron_variant | ||||||
VEP_impact | HIGH | |||||||
cDNA_position | ?-129 | |||||||
CDS_position | ?-111 | |||||||
Protein_position | ?-37 | |||||||
Intron_number | 2/7 | |||||||
Exon_number | 1-3/8 | |||||||
Isolation | Mutagen | TMP/UV | ||||||
Genetics | Map | III | ||||||
Description | Phenotype | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0000688 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Classified as lethal OR sterile by the National Bioresource Project of Japan. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | FX | |||||||
WBPhenotype:0001302 | Person_evidence | WBPerson7743 | ||||||
Curator_confirmed | WBPerson712 | |||||||
Remark | Comments to the National Bioresource Project of Japan: Dr. H. Zhang: accumulation of several germline P granule components in somatic cells. | Person_evidence | WBPerson7743 | |||||
Curator_confirmed | WBPerson712 | |||||||
Laboratory_evidence | HZ | |||||||
Remark (2) | ||||||||
Method | NBP_knockout_allele |