WormBase Tree Display for Variation: WBVar00250567

WBVar00250567 Evidence: Person_evidence: WBPerson59725
      WBPerson12585
    Laboratory_evidence: SBW
    Remark: Email received from WBPerson59725 and WBPerson12585: "My lab would like to report a misannotation that we discovered for the allele: (lem-2) tm1582. While there is an "A" insertion mutation with a deletion mutation, the placement of these mutations does not result in a premature stop codon as annotated, but instead causes the transcript to remain in frame. I'm attaching an annotated file that better explains what we've found."
  Name: Public_name: tm1582
    Other_name: CE20129:p.Asn22_Ter283delinsLys
      W01G7.5.1:c.66_849delinsA
    HGVSg: CHROMOSOME_II:g.14063520_14064359delinsA
  Sequence_details: SMap: S_parent: Sequence: CHROMOSOME_II
    Flanking_sequences: ccgcgccgagttgaacgttcgcggggcgaa ttcgatgcgtccaagaatccaggagacagc
    Mapping_target: CHROMOSOME_II
    Source_location: 7 CHROMOSOME_II 14063518 14064360 Inferred_automatically: National_Bioresource_Project
    Type_of_mutation: Insertion: A
      Deletion
    PCR_product: tm1582_external
      tm1582_internal
    SeqStatus: Sequenced
  Variation_type: Allele
  Origin: Species: Caenorhabditis elegans
    Strain: WBStrain00003834
      WBStrain00003846
    Laboratory: FX
    Author: Mitani S
    DB_info: Database: National_Bioresource_Project seq 1582
    NBP_allele
    Status: Live
  Affects: Gene: WBGene00002275
    Transcript: W01G7.5.1 (11)
    Interactor: WBInteraction000505178
      WBInteraction000544762
      WBInteraction000579029
  Isolation: Mutagen: TMP/UV
  Genetics: Map: II
    Mapping_data: In_multi_point: 4984
  Description: Phenotype: WBPhenotype:0000771 Paper_evidence: WBPaper00046424
        Curator_confirmed: WBPerson1780
      WBPhenotype:0001027 Paper_evidence: WBPaper00046424
        Curator_confirmed: WBPerson1780
    Phenotype_not_observed: WBPhenotype:0000030 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comments to the National Bioresource Project of Japan: Dr. A. Dernburg: No defects in growth, Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
      WBPhenotype:0000062 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
      WBPhenotype:0000276 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comments to the National Bioresource Project of Japan: Dr. M. Hengartner: normal sensitivity to X-radiation. Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
      WBPhenotype:0000688 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comments to the National Bioresource Project of Japan: Dr. A. Dernburg: No defects in fertility Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
      WBPhenotype:0001499 Person_evidence: WBPerson7743
        Curator_confirmed: WBPerson48
        Remark: Comments to the National Bioresource Project of Japan: Dr. A. Dernburg: No defects in meiotic chromosome behavior Person_evidence: WBPerson7743
            Curator_confirmed: WBPerson48
  Disease_info: Models_disease: DOID:11726
    Models_disease_in_annotation: WBDOannot00000047
  Reference: WBPaper00046424
  Remark: [W01G7] 32536/32537-A-[Y39G8C] 509/510 (838 bp deletion + 1 bp insertion)
    This knockout was generated by the National Bioresource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. Paper_evidence: WBPaper00041807
    Old Mapping_target W01G7 updated based on the VEP analysis pipeline to CHROMOSOME_II.
    Corrected left flank to fix misannotation. Curator_confirmed: WBPerson51134
  Method: NBP_knockout_allele