WormBase Tree Display for Variation: WBVar00250520
expand all nodes | collapse all nodes | view schema
| WBVar00250520 | Name | Public_name | tm1530 | ||||
|---|---|---|---|---|---|---|---|
| Other_name | T19B10.11.1:c.211_319-305del | ||||||
| HGVSg | CHROMOSOME_V:g.11245049_11245482del | ||||||
| Sequence_details | SMap | S_parent | Sequence | T19B10 | |||
| Flanking_sequences | GGGGAAAGGGTTCAAGCATCGAGAGCTGTC | AGAGTTACTGTAGTTTTCGCAACGAAATAT | |||||
| Mapping_target | T19B10 | ||||||
| Type_of_mutation | Deletion | ||||||
| PCR_product | tm1530_external | ||||||
| tm1530_internal | |||||||
| SeqStatus | Sequenced | ||||||
| Variation_type | Allele | ||||||
| Origin | Species | Caenorhabditis elegans | |||||
| Laboratory | FX | ||||||
| Author | Mitani S | ||||||
| DB_info | Database | National_Bioresource_Project | seq | 1530 | |||
| NBP_allele | |||||||
| Status | Live | ||||||
| Affects | Gene | WBGene00003509 | |||||
| Transcript | T19B10.11.1 | VEP_consequence | splice_donor_variant,coding_sequence_variant,intron_variant | ||||
| VEP_impact | HIGH | ||||||
| HGVSc | T19B10.11.1:c.211_319-305del | ||||||
| cDNA_position | 211-? | ||||||
| CDS_position | 211-? | ||||||
| Protein_position | 71-? | ||||||
| Intron_number | 1/2 | ||||||
| Exon_number | 1/3 | ||||||
| Isolation | Mutagen | TMP/UV | |||||
| Genetics | Map | V | |||||
| Description | Phenotype | WBPhenotype:0000229 | Person_evidence | WBPerson7743 | |||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Comment to the National Bioresource Project of Japan from Dr. J. Kaplan: slight Sma. | Person_evidence | WBPerson7743 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Laboratory_evidence | KP | ||||||
| Phenotype_not_observed | WBPhenotype:0000062 | Person_evidence | WBPerson7743 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Classified as homozygous viable by the National Bioresource Project of Japan | Person_evidence | WBPerson7743 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Laboratory_evidence | FX | ||||||
| WBPhenotype:0000640 | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Comment to the National Bioresource Project of Japan from Dr. J. Kaplan: non-Egl. | Person_evidence | WBPerson7743 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Laboratory_evidence | KP | ||||||
| WBPhenotype:0000643 | Person_evidence | WBPerson7743 | |||||
| Curator_confirmed | WBPerson712 | ||||||
| Remark | Comment to the National Bioresource Project of Japan from Dr. J. Kaplan: non-Unc. | Person_evidence | WBPerson7743 | ||||
| Curator_confirmed | WBPerson712 | ||||||
| Laboratory_evidence | KP | ||||||
| Remark | 26865/26866-27297/27298 (432 bp deletion) | ||||||
| This knockout was generated by the National BioResource Project, Tokyo, Japan, which is part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use. PMID 23173093 | Paper_evidence | WBPaper00041807 | |||||
| Method | NBP_knockout_allele |
